Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15753  (registered. 2002)
Contig Information
Length 664 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 6
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0178400 [Oryza sativa (japonica cultivar-group)] >gi|585963|sp|P38385|SC61G_ORYSJ RecName: Full=Protein transport protein Sec61 subunit gamma >gi|50252067|dbj|BAD27997.1| transport protein SEC61 [Oryza sativa Japonica Group] >gi|113535607|dbj|BAF07990.1| Os02g0178400 [Oryza sativa (japonica cultivar-group)] >gi|125538321|gb|EAY84716.1| hypothetical protein OsI_06084 [Oryza sativa Indica Group] >gi|125581025|gb|EAZ21956.1| hypothetical protein OsJ_005439 [Oryza sativa (japonica cultivar-group)] >gi|149392497|gb|ABR26051.1| protein transport protein sec61 gamma subunit [Oryza sativa (indica cultivar-group)] >gi|215686621|dbj|BAG88874.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768301|dbj|BAH00530.1| unnamed protein product [Oryza sativa Japonica Group]
Score 249
Evalue 8.85411e-20
Total Hit Count 164
Registered year 2002
Contig Sequence     [ Download ]
>Contig15753
ataAAAGGCATCACAAG*AATGCAAAACCATCGACACAAAATCGATGGGAGTATACTGCGAA*GAACTTGTACT*CGATT*CGCTGAAAATGTTTTTAAT
CACAATG*CATGCACTTCCAGTTTGAAGTTGCTTATGACAGGACACGGAGGAACATAACAGTGGACTAGACAGTCCGTTGCTGCCTTCCGACACAAAATA
AACCAGCCATCAAATAGACATCAACTCCAGGTAGCCCATCAGTA*GAAGAAAAATGGAGAACACCATCCTGAATCAACCGTAGATAAGCTCTCCTGCGCG
AGGCGGATCCGGATCTAGTGGCCGCCGTGCTTCTCGAGGTGCTCGAGGTGGCGGCGCTCCTGGGGCAGGCCCACGAGGTACGAGAAGGCCATGCCGCCGA
AGCAGATGTTGTTGATGGGGATGAAGATGAGCTTGACGAAGAACCCGACGAAGCCCATGACGACGAACCCGATGGCCGTCCGAATGGCCACC*TTGGTGA
ACTCCTTTCGGTCGGGCTTGTGGCAGCGCTTGACGAGGCGAACGCTGTCCTTGGCGAACTCCCGGAGCGGGTCGACCACGGAGTCCACGGCGTCCATGGC
TGGCTGCGGCGCGGGGAGGAGGGAGAT*CTCGCCGGAGAGGTGGGAGGCAGAATGTGgaggtgc
page-top