Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15749  (registered. 2002)
Contig Information
Length 637 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 4
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 4
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit acidic ribosomal protein [Triticum aestivum]
Score 253
Evalue 2.84887e-20
Total Hit Count 95
Registered year 2002
Contig Sequence     [ Download ]
>Contig15749
tttttttttTGAGAGAAACATAACTCCAGCAAATTATCAATCAACTTCTCAACGCTGCGGAAGCAGTAACACACTCACATACTAAGGTACTAAACATATA
CATTGTCCCAAGCAAAATAGCACGAACTTTAGGTCTCTAG*ATATTATGCAGGCGCTGTTGTGGCAGGCCACACACGACAGATACTAGGGTAAACAGAGG
GTAGGGGGGAGGAACTGAAGCGCTTAGTCGAACAGACTGAAACCCATGTCTTCATCAGATTCTTCCTTCTCTTCAACCTTCTCCTCCTTTGACTCAGCAG
CAGGTGCGGCGGCACCACCAGATGCAGCAGCTGGAGCTCCCACAGCAATGGCACCCCCACCTGAAGGCACAGCGGCAAACTTCTCCCTTCCAGATGCAAT
CACTTCTGTGATGTCCTTGCCTTTGAGTTCAGCCAGAAGGAACTCAAGCTTTTCTTCATCAGCCTCGGCACCAACTGAGTCCAGGATGTTCTTGACGTCA
GCGGCACTTGGGGAAGAGTTCCCACCCAGATAGGCGAGGAGGTAGGCAGCGATCAGCTTCATCGTGGAAACTAGGAAGCACCTCCGAGATGCGCAGGAGA
AGACGCGAGGTCGGCGGCGGAGGGGG*TTCGTGCgcc
page-top