Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15740  (registered. 2002)
Contig Information
Length 1410 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 2
Wh_h Spike at heading date 10
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_26282 [Oryza sativa Indica Group]
Score 1517
Evalue 2.93019e-166
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15740
gcTCCACCCATCTCAGCAAAAAAGAAGCTAGCACAG*CTCCACACACCATGGCAGCCATGGCCACCACCGCCTCCAGCCTCCTCAAGCCCTCCTTCTCCG
GCGTCCGCCTCCCGGCGGCGGCCCGCACCCCGTCCTGCGTCGCCACCCCGCGTGCCGGCGCCATCTGCAACTCCATCTCCTCCTCCACACCTCCCTACGA
CCTCAACGCCTTCAAGTTCAGCCCCATCAAGGAGTCCATCGTGT*CCCGCGAGATGACCCGCCGCTACATGACCGACATGATCACCTACGCCGACACCGA
CGTCGTCATCGTCGGCGCCGGATCCGCGGGGCTTTCCTGCGCGTACGAGCTCTCCAAGGACCCCTCCATCAGCATCGCCATCATCGAGCAGTCCGTGTCC
CCCGGCGGCGGCGCCTGGCTCGGCGGCCAGCTCTTCTCCGCCATGGTCGTGCGCAAGCCGGCGCACCTCTTCCTCGACGAGCTCAACATCGAGTACGACG
AGCAGGAGGACTACGTCGTCATCAAGCACGCCGCGCTCTTCACCTCCACGGTCATGAGCCGCCTCCTCGCGCGCCCCAACGTCAAGCTCTTCAACGCCGT
CGCCGTGGAGGACCTCATCGTCAAGGAGGACCGCGTCGCCGGCGTCGTCACCAACTGGGCGCTCGTCTCCATGAACCACGACACACAGTCCTGCATGGAC
CCCAACGTCATGGAGGCCAAGGTCGTGGTGAGCTCTTGCGGCCACGACGGG*CCCTTCGGCGCCACCGGGGTCAAGCGGCTCCAGGACATCGGCATGATC
CAGGCGGTGCCCGGGATGAAGGCGCTCGACATGAACACGGCCGAGGATGCCATCGTGCGCCTCACCCGGGAGGTGGTCCCCGGCATGATTGTCACCGGCA
TGGAGGTCGCCGAGATCGACGGCGCCCCGAG*AATGGGCCCGACCTTCGGCGCCATGATGATCTCCGGCCAGAAGGCGGCGCACCTGGCGCTCAAGGCCC
TCGGCCGGCCGAACGGCATCGACGGGACGCTCAAGAACGTGACCCCGGCGCTGCACCCGGAGATGATCCTGGCGGCGACCAACAACGGCGACATCGTGGA
CGCCTAAGCAAAGCAATGAACCACGGACACCAAGGCGTACGTACGCTGGTGTTTCGGGGCGAAAAATCAATAAGATGGTTCGGTGAAACAGAGGATGCTT
AGGGACGAGGTCTTGTCTTTGTGATTTGTCAGACTCGTGTTTAATTCCGATGTTTATCTTTAGTTTTCTTGTGTTAGCGTATTTTGTTCATGCCACCTGC
CCGCCATGTGCTCTGCTCTGCCTCTGCCTCACGGCAGCT*CCATGGATGATGAATCCTTATGGAACAAGAGG*AGGGAATAAAAAGGTTGAGTTCTATGt
aaaaaaaaaa
page-top