Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15720  (registered. 2002)
Contig Information
Length 935 bp
Clones 28 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_SL Seed DPA30 4
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 7
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0558600 [Oryza sativa (japonica cultivar-group)] >gi|109940139|sp|P40392|RIC1_ORYSJ RecName: Full=Ras-related protein RIC1 >gi|57899331|dbj|BAD87942.1| Ras-related protein RIC1 [Oryza sativa Japonica Group] >gi|57900421|dbj|BAD87657.1| Ras-related protein RIC1 [Oryza sativa Japonica Group] >gi|113532867|dbj|BAF05250.1| Os01g0558600 [Oryza sativa (japonica cultivar-group)] >gi|125526416|gb|EAY74530.1| hypothetical protein OsI_02420 [Oryza sativa Indica Group] >gi|125570818|gb|EAZ12333.1| hypothetical protein OsJ_002158 [Oryza sativa (japonica cultivar-group)] >gi|215769435|dbj|BAH01664.1| unnamed protein product [Oryza sativa Japonica Group]
Score 604
Evalue 2.35472e-103
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15720
ctTCTCCCCAAATTCTCACCTTTCCTCTCCCTCGGTCGTCGCCTTCGCCTCCCGGG*AAATCGCCTGCCGCCTCGTCTCCTAG*AAACTCTCCGCCGCCG
TCCGCTGCCATG*AATCCTGAATATGACTACCTCTTCAAGCTGCTGCTCATTGGGGACTCGGGCGTGGGGAAGTCCTGCCTGCTGCTGAGGTTTGCGGAT
GATTCATATCTGG*AGAGCTATATCAGTACTATTGGTGTTGACTTCAAAA*TCCGCACCGTTGAGCAAGATGGGAAGACGATAAAGCTGCAAATTTGGGA
TACTGCTGGCCAAGAGCGATTTAGGACCATCACAAGCAGCTACTACCGCGGGTGCCCATGGCATCATTGTTGTGTATGATGTGACTGACCAGGAGAGCTT
CAACAACGTCAAACAGTGGCTTAATGAAATCGACAGGTACGCTAG*TGAAAATGTGAACAAGCTTTTGGTGGGGAACAAGTGCGATCTAGCTGAGAGCAG
AGTGGTTTCTTACGAGGCTGGCAAGGCCCTTGCCGATGAGATTGGAATACCATTCCTGGAAACCAGTGCCAAGGATGCAACAAATGTGGAAAAGGCATTT
ATGACCATGGCCGCAG*AGATAAAGAACAGGATGGCAAGCCAGCC*GGCTGGAAATGCCAGCAAGCCTGCCACCGTGCAAATGCGGGGTCAGCCTGTTGC
TCAGCAGAACGGATGCTGCTCGTCTTGATCAACACTCAAAGATCACAGTAGTGTTCTTGCAAAACTCAATTG*GTTGTT*CTT*CCCCTGTAAATTAAGT
GTACTACTATCATGCCGT*CTGTTGGAAGAAGTGTCATGTCCCCTAACTACAACAGTGCAGCAGATGCTG*GG*CCTGTTTTAGCtg*acTGTTAATatt
gctatTTTAATGTGTGTCgtttactaaaaaaaaaa
page-top