Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15703  (registered. 2002)
Contig Information
Length 558 bp
Clones 28 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 10
Wh_oh Pistil at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HvB12D [Hordeum vulgare subsp. vulgare] >gi|3445292|emb|CAA70936.1| B12Dg1 [Hordeum vulgare subsp. vulgare]
Score 453
Evalue 1.26397e-43
Total Hit Count 47
Registered year 2002
Contig Sequence     [ Download ]
>Contig15703
ttttttttttcaatgaaacagataTTTAGAAGCCATCAACCATCACATATATAGCAAGCCATCAAACATCACATGGTT*CTTTCAATAAG*AGGCACTTG
ATGATATCCTCTGAATTATGGACGCGACAACATTACTGAATGCTTGAAATAGGTTTGCACTTGACCACAACAGTTACTAATAGCGAGCCACTGACAGGCT
AAAGTGCTTCATTTCGGGCTGGTGAAGAACTTGTTGATT*CCTGGCATGATCT*CGGGGGT*CTTGT*CCTGCACATAGGCTCTGAGGCCATGCTCGGCG
TAGCGCCTGCCCTCCTCATGGTTCTCAAGCACTCCCGCTGCCCTCCCCATCTTGTTGACCCTGACTTCTGGGTTGCCGGTGATGTTGCGGAGGAGGCTGA
AGGCGCAGATGCCGATGGCGACGCCCGTCGCCGCGAACAGCGGGTACACCTCGGGCCTGACCCACTTGCTGGCCATCGGAGTCGCGGGGAGGACGCTGCG
CCGGCGGCGGAGGGGGAGAGTG*AGTGAGAGAGACGAAAGTGGAGAGGCGACGGCGgc
page-top