Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15696  (registered. 2002)
Contig Information
Length 629 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_dL Crown of seedling 7
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to germinal histone H4 gene [Canis familiaris]
Score 418
Evalue 1.99576e-39
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15696
ggctgcaggaaatTCGGCACGAGGCGCTCCTCGACCTTCATCCGCTCTCTCAG*CTCGAACCAAGGCGAGTTCGTCGGCGACCATGTCTGGGCGCGGCAA
GGGAGGCAAGGG*TCTCGGCAAGGGCGGCGCCAAGCGCCACCGGAAGGTGCTGCGCGACAACATCCAGGGCATCACCAAGCCGGCCATCCGGCGCCTGGC
TCGG*AGAGGCGGCGTGAAGCGCATCTCGGGGCTCATCTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCAC
CTACACGGAGCACGCCCGCCGCAAGACCGTCACCGCCATGGACGTCGTCTACGCGCTCAAGCGCCAGGGCCGCACCCTCTACGGCTTCGGCGGCTAGGCG
TCCACCTTCGTCCGCAGCTCGTCGCCGCCTCGTCGTCAGTCAACAACTCCGCCCCGCTGTGGCCCCGGGCGCGAGGAAACTGCCATGTCTTATGTTCAGT
AGCTGTAGCCGGAACAATGTCACCTGTTCCCCCATTT*GTCTATCGCAGAATCT*CT*CTAGTTACCTTGTAGCTCCATGAGCCCAGTTGTGAAATCGAA
TATATCGTCTT*CCCGTGcaaaaaaaaaa
page-top