Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15694  (registered. 2002)
Contig Information
Length 1748 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_SL Seed DPA30 5
Wh_e Seed DPA10 3
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Eukaryotic initiation factor 4A; Short=eIF-4A; AltName: Full=ATP-dependent RNA helicase eIF4A
Score 2046
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15694
attcggcacgagggtcgagccgcgcgccgcttccgtcggggaccaatataagccggctttctctctccttctccccacagcccaccaAACCCTCGCTCTT
CCCACCGCAGG*AAAGAGCTCCCTCTCCCCT*CCCCACCCC*ACCGCCTCCGCCGACGAACCGATCGAATCCGGGACCCCGATCTCGGATTCGCTCGGCA
GATCAG*CGCGCACCAGCCCCCAAggcCCCCGGATCCTCCTTCGTCCTCCCCACCGCGCGCTTCAGCCATGGCAGGAATGGCACCA*GAGGGTTCCCAGT
TTGATGCTAAGCAGTATGACAGCAAG*ATGACCGAGTTACTGAACCAAGGTGACACTGGGGAGTTTTTCACCTCGTATGATGAGGTGCACGAAAGTTTTG
ATGACATGGGCCTCCAAGAGAACCTTCTTAGAGGCATCTATGCTTATGGTTTTGAGAAGCCATCAGCCATTCAGCAAAGAGGAATTGTTCCCTTCTGTAA
GGGTCTTGATGTGATTCAGCAAGCTCAGTCTGGAACAGGAAAAACTGCCACCTTCTGTTCTGGAATCTTGCAGCAGCTTGACTACGGATTGGTTGAGTGC
CAGGCATTGGTCCTTGCTCCAACCCGTGAGCTTGCACAGCAGATTGAGAAGGTCATGCGTGCTCTTGGTGACTACTTAGGCGTCAAGGTGCATGCATGTG
TTGGTGGAACTTCTGTTCGTGAGGACCAAAGGATTCTTGCCAGtggggtGCATGTTGTTGTTGGCACACCTGGTCGTGTGTTTGATATGTTGCGCAGGCA
ATCCCTCCGCCCAGATAACATCAAGATGTTTGTGTTGGATGAAGCTGATGAGATGCTTTCACGTGGTTTCAAGGATCAGATCTATGATATCTTCCAGCTT
CTTCCATCAAAGATTCAGGTTGGGGTGTTCTCTGCTACCATGCCTCCTGAGGCCCTTGAGATTACCCGCAAGTTCATGAACAAGCCCGTGAGGATTCTCG
TCAAGAGAGATGAGCTTACCCTTGAGGGTATCAAGCAGTTCTATGTCAATGTGGAGAAGGAAGAGTGGAAGCTGGATACACTCTGTGACCTGTACGAGAC
C*TTGGCAATTACCCAGAGTGTCATCTTTGTGAACACCCGCCGCAAGGTGGACTGGCTCACCGACAAGATGAGGGGAAGGGACCACACTGTCTCTGCCAC
GCACGGAGACATGGACCAGAACACTAGGGACATCATCATGAGGGAGTTCAGATCTGGATCTTCTCGTGTGCTCATCACCACTGACCTGCTGGCCCGTGGT
ATTGATGTGCAGCAAGTCTCCCTTGTCATCAACTACGACCTGCCAACTCAGCCCGAGAACTACCTCCATCGCATTGGTCGTAGTGGTCGGTTCGGGAGGA
AGGGAGTTGCCATCAACTTTGTCACCCGTGAAGATGAGAGGATGCTGTTCGACATCCAGAAGTTCTACAACGTGGTCATTGAGGAGCTCCCGGCCAATGT
CGCTGACCTGCTCTAGATTATATCTTAGGAATGCAGTAAGGTGCTTGATAAAGTTCGTTTTTGTTGAATATCTCCCAACT*CTCAGTTTTGG*AGTGGTA
AGGT*CTGGGT*CTGTTTGAATCGTCGTTAAGGATGGTCTGAGTTTTTCTTGTTATGCAATGTCCGGAAATTTTTGTAGTGCGTAGGCTGTGCCATCTCC
TGGGCTAGCTGGGATAGAGTAACTCTCATAAGTATTTTACTTTTCgtt
page-top