Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15667  (registered. 2002)
Contig Information
Length 1405 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 8
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0149800 [Oryza sativa (japonica cultivar-group)] >gi|51535961|dbj|BAD38042.1| putative protein phosphatase 2C [Oryza sativa Japonica Group] >gi|113535429|dbj|BAF07812.1| Os02g0149800 [Oryza sativa (japonica cultivar-group)] >gi|215694584|dbj|BAG89775.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1297
Evalue 9.46296e-141
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15667
ccgaactgctgtagtgtgacaccatgagcacaactttgttcaaatcattcaaatAGTCAGGTTACATGCATTTACTGCTAAAAATCACTAGCATGAAACA
CCAGCATAGAAGCTACACAGTACAAGGTTCAGCATGAAGAAAGAAAAAGTACCCCTTGGATCATATGGTAACAACACTGCCTCACCATCCCCCTGTGTTC
CGACATTACCTACCATCTAGGATAGCCGGGAGCATGGAACAACGACGAAACTCAGGCCAAGT*CAGTTTCGGTTTCGCAGCACGGGAGGGCGCCGCCACA
TGACATCTACTTTGAGCATCAGATACAACAGCGGATACAACGCCGTGGAGGAACAAGAACTATGAAGATTGGTCCTTGGCGACCTCCTCACTTTGGTCCT
TGGCAACCTCCTCGCTCGGTCCATCTCCAGCAGACGTCGTCGTTCCGTCCAAGAAGCGAACAATGACGACAGTGATGTTGTCAGCACTGCCCCTTTGAGA
AGCTTCTTGAAGTAGTCCCTTC*GCCGCTTGCTCAGGATCTTCTACTGGCTTGACCATGGCAACAGCTTCATCGTTAGTTACAACATCCCATAGCCCATC
ACTAGCAAGGATAAGGAATTCAAGTGAGC*TGTCAACTACCTCCTCCTTGATCTCTGGATCAGCGACAACAT*ACTGCTTTAGAAGTTTATCACCAAATG
CGCGAGAAACAGCAAGAACACCACCAACACGCCATGTCCCAGCCCACATCACAAAGCCTCCAGCTTCCTCAATTCTCTGTCTCTCATCTGTCTGGTCAGG
TTTGTGATCCCTGGAAACCGCAATAGCCTTCCCTCCTTTAGAAACAACAGCTCTAGAATCACCAACATTTGCAACCACCAAGCGACCACCGACAAGAATA
GCTGTTGAGGCAGTTGAGCCAGCATCTCTGGTGTGGCTACTATCAGCTTTCAGAAACTCTGAATCGGTATGATTGAATGTTTCAGCAATAGCAGCCTTTG
TATCTGTCATGAATTTCGGATGCTTGATTAAATTGCTGAAAAGGTGCTTCTTCACATATTCAGCTGCTCGAGCTCCGCCGTGACCATCAAATACGCCAAA
CAACCCAACAGTCTCTCCATCAACATCATCCACTCTTGTCTCGTAGAAATCCTCCATAGATGCCCTTTTCCCAGCACAGCTTGCAAACCCATAACTGAAC
CTGCCTTTTTCACTGATACCGCCTCCGGTGACCGGCGAGTCGTCGCCCCTGAACCCCATCAGGGAGCACCCCTCGTCGTCCTCGCGGCACCACCAGCCGT
GCGAGCGCCCGGCGAGCAGGGACAGCGACAGGAGCAGGAGCAGGAGCAGGGAGGCGGAGGAGGGGAGGCGCGTGGCGGCTAGCGATGGCCCCGGCGaccc
ctcgt
page-top