Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15665  (registered. 2002)
Contig Information
Length 624 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0815000 [Oryza sativa (japonica cultivar-group)] >gi|47847878|dbj|BAD21671.1| putative ribosomal protein L37 [Oryza sativa Japonica Group] >gi|113538029|dbj|BAF10412.1| Os02g0815000 [Oryza sativa (japonica cultivar-group)] >gi|125541603|gb|EAY87998.1| hypothetical protein OsI_09420 [Oryza sativa Indica Group]
Score 481
Evalue 9.62855e-47
Total Hit Count 299
Registered year 2002
Contig Sequence     [ Download ]
>Contig15665
acaacttgagcaatatctcatattgaaacaacaaaAAGACTCATCACAAATAGCACATTGAACAAGAGATGCAGCATCTAACACAGG*ACATCGACACGA
TTCAACATTCAAAACTGAAGGATTAATGTCCACGACAATTGTGCAAATAACATAACCAGGCACCATATCGTCTGCCTCTCGACATAGAAACATAGAG*TT
CCAGTAGAAATCAACAAAAAAAGCTAAGTTTGATGATCAGGGCTTCGCTTAGGGCAACAAATGGAGACTGTCACACCTAGTTGCCGCTGGAAGAGGCTCC
CTTGCT*CCTTGGTGCGGCCTCAGTTCCCTCTCTGAAGTTGCTCTTGAACCTCCTGGGCACGTGGC*GCATGTACCTCATCCTCCCGGTGCCGGTGGTCT
TCCTCCTGATGGCCTTCACACTCCAGTTGTACTTGCGGATGCGGGCGGCGGGGTAGCCGCACGAGGAGCAGGTGCTCTTCTGCAGGTGGAAGCTGCGGCG
GCCGCAGCGGATGCACAGCGTGTGGGTCTTGTTCCGGCGCTTGCCGAAGCTGCCCGTTCCCTTCGTCATTTCGCCTT*CT*CCTGTCGCCGCTGCGCCCT
CGTGCCGAATCGGCACGAGgcctc
page-top