Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15642  (registered. 2002)
Contig Information
Length 747 bp
Clones 26 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 5
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 9
Wh_r Root 5
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0353400 [Oryza sativa (japonica cultivar-group)] >gi|32352142|dbj|BAC78564.1| hypothetical protein [Oryza sativa Japonica Group] >gi|50293119|gb|AAT72926.1| 17.7 kDa low temperature induced protein [Oryza sativa (japonica cultivar-group)] >gi|108708166|gb|ABF95961.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113548598|dbj|BAF12041.1| Os03g0353400 [Oryza sativa (japonica cultivar-group)] >gi|125586268|gb|EAZ26932.1| hypothetical protein OsJ_010415 [Oryza sativa (japonica cultivar-group)] >gi|215692795|dbj|BAG88239.1| unnamed protein product [Oryza sativa Japonica Group]
Score 471
Evalue 2.08428e-45
Total Hit Count 78
Registered year 2002
Contig Sequence     [ Download ]
>Contig15642
caaatcacaCTGAACATCGGTTGCATTTTGTTGCCTTTTTCTTAGGTCATTTCATTTCTACGTACTT*AATATAATATACAAACGG*A*CACCACTACTT
ACTACTAGTAGAAGAAGACTTGAAAGATGAG*ACGGCGGCGGCAGCCAG*AGCAATGCATCACTGCAGGCGCAGGATTTGCTCGATTCTTGAAGCTTGAC
ATCCCAACCTAGCGAGGCTGGTGGATGAAGCGCGGTGCGCCACCGCTCCTCGGGCTGCCGGCGTACTTGGTGGGCTTCTCGGTGTACCTAGGCTTCTCCG
AGAAGCCACCCTTTGGGCTTGGGGACGCCAGGCTCAGCGCCTTGAGCACCCCGTCAATCTTGAGTGCCGCTGGCGGCTGCGGCTGCGAAGCCTCGACGGC
GATGGCGTCCTCGGCCTCCAAGGCCATGAGGGAGTCGACCATATCGTCGAGCTGCTGGTGCTGGTGGTACCAGTGGTCGCGAAACCAGGCGGTGGACTTG
ACGAGGTCCCACCACT*GCGGTGAGAAGTCCTCCACCTGCTGGAACGCTGCCGGGATGAAGAGCGGGGCCTCCGGGTTAAGCGACGACGCGACCATGGCG
CTCATGGTCTCCCTGTTGCTCTTGGTCTGTTCCTTGGATTGGGGTTGGGGATCGCAGGAGCAGGG*TCGGTTGGGGATCGCAGGAGCAGGGTCAGGATAG
AGAATCTGGATCTGGATAGTGGACCgccgcctcgtgccgaattcctg
page-top