Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15604  (registered. 2002)
Contig Information
Length 1887 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 7
Wh_oh Pistil at heading date 2
Wh_r Root 10
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phenylalanine ammonia-lyase [Hordeum vulgare subsp. vulgare]
Score 2472
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15604
ttttttttttaATACAAGCAAAAAAAGAACCACATAGTATTAGCATGATTCACCCCAAAATACAACGACAATAATATCTTT*AGGTAAAG*CTGCGGCAG
AGCAGCTACACAATTAACAACAAGGCCACACGTCGATCAACACCAACGCACGAACAACGAAAGGCAAAAGGCGATAGG*AACTGAAGAAG*AAG*AACAT
GCACGAACGAATTAAGCGTCTTATTTTTGGATGTACTCTGGAAGCCTCCTCCTCCTCCTCTCCTCCACGGTCGCACGGACGATGCTTCAGACGTTGATGG
GCAGGGGCTCGCCGTTCCACTCCTTGAGGCACTCCAGCATGGGGTCGATGAGCTTGTTCTGGCTGATGCCCAGGAAGACCTTGGTGCACTCCTCGCCGGG
GGACAGCAGCTTCTCGCCGGTGAGGTACACGCAGCCGAGCTCCTCGCGGACGAAGCGGTACAGGGGGAACGACCTGCTCTCCTTGATCAGGTTGGGGATG
GGCGCGGTGCCGTTCTCGAAGGCCACGCGGGCGGCCTCGATCTCCCGCGGCAGGGCCGACCGCAGCTCCTCCTCGAACTTGTTGATCTTGGAGAACACCG
TGGCCTCGCTCTCGGCCTCGCCGGGGCCGGCGGTCAGGGCGTGGTCGACCAGCACGGCGCGCAGCTTCTGCATCAGTGGGTAGTTGGCGCTGCAGGCGTC
GTCGGCGTAGCTGAACACGGCCTCGCGGTCGATGGCGGTGATGAGGCTCTTCTCGCTGAAGCGCGCGCTGGAGAGGTCGCCGGTGGGGTTCATGGTCAGC
ACCTTCTTCGACACCTGCGTCACGCAGTTCTTCACGGAGGTCTTGATGTTCTCCTCCAGGTGGCGGAGGTCGATGGCCTGGCACAGCGCCACCATGTATG
TGGAGGACATGAGCTTGAGGATGTCCACGGCCTCGGCGGTCTTCCTGGCCGAGACAAGGCCCAGAGAGTTCACGT*CCTGGTTGTGCTGCTCAGCACTCT
GGACATGGTTGGTCACCGGGTTGGCAAGGTACTGGAGCTCAGAGCAGTAGGAAGCCATGGCGATCTCcgtGCCCTTGAAGCCGTAGTCCAGGctcgggtT
GCGGCTgcctgcCAGGTTGGAGGTCAGCCCGTTGTTGTAGAACTCGTTGACGAGCTCCGAGAACTGCGCGAACATGAGCTTGCCAATGTTGGCGATGGCG
AGACGGGTGTTGTCCATGGACACACCGATGGGCGTGCCCTGGAAGTTGCCGCCATGGAGTGCCTTGCCACGGTGGACGTCGATGACGGGGTTGTCGTTGA
CGGAGTTGACCTCGCGCTCGATGGACTTGGTGGCAGACCGGATGACCTCGATCTGGGGGCCGAGCCACTGCGGCGACGTGCGGAGCGCGTACCTGTCTTG
CTTGGGCTTGAGCTGCGTGTCAATCTCGTTGACCTTCTTGGCGTGGCCCATGAAGGCGCTGCCGGCCAGGATGTGCTCCATGATGGCCGCGGCCTCGATG
GAGCCGGGGTGGTGCTTGAGCTTGTGAGTGAGGTGGTCGGTGAACTCGGGCTTGCCGTTCATCACCTCGCAGAAGACGGCGGACAGGACCTCGGAGAGAA
CAGCGAGGACGTTGCAGTCGAACAGCACCGTGGCCGCGAGTGCAGAGCCCACGGACGTGCCGTTGACAATGGCGAGACCCTCCTTGGGGTTGAGCTTGAA
GAAGCCGCCCTCGATGCCAGCGGCCTTGAATGCCTCGGCGGC*GTCCACCTtctttcCATcAACAGTGGTGGCCTGCGCGTTGGGGCGTCCGGTGATGag
cccgGCGATGTAGGACagcggcACAAGGTCGCCGGAGGcggtgatggtgccccggagcggtaggcaggggctgaccctcgtgccgaa
page-top