Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15590  (registered. 2002)
Contig Information
Length 1082 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 3
Wh_f Spike at flowering date 5
Wh_oh Pistil at heading date 4
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit nucleosome chromatin assembly protein [Oryza sativa (indica cultivar-group)]
Score 931
Evalue 1.77963e-98
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15590
ttttttttttcagCAAGTTAAATTGTTGTCATAGATATCGCCAGATTATGATATATAGAGGTCTCCTTTAAGT**CGAAAATACGACAGTACGTACTCGA
TAACGCATTCAACAGCTCCTAAGGCTAAGTTCCAGCTAAGTCAAACACAAAACAAAACAGTCTCGAAAGGGTCACATGACTACACCCTTCAGACACCCAC
AGCCTCTGCAGACAACGATTCATCAGGACCCACCAAAGCCAACCAAGGCCTCAGTTCT*CCTCGTCCTCATCCTCCTCAGCATCCTCCCCATCAGATCCC
TCTTCATCCTCGTCATCTCCTTCAAACTCTTCAACCTCATTGTTGAAATATTTCAATGGGTTCGGCCACAAATCTTCTTTGATGATCTCTGCCACCTCAT
CTTGCACCCCATCAGCAAGGCTCTTGTGCTCTGTATCAGTGAACCAGGTGAAGAAACTTTCTTCAACCAATGGACGCTTGCTTCCTTTCTTCTTAATGGC
ATTCCCATTAATTTCCATTCCCTCCTTCCACTT*AATGGAAGTGGCATTTATTGTGG*TTGTTCCATCAT*CAGCAAAGGCATA*TGACTTGGTAAGCTT
TCTGTCTTCAAAGTACGGATTCTCAG*AGAAGTTAAGAGTGATGGAGTAGCCTGACTTGACATCTTTAGAGTCATCAACATCAACAGATTCCAAGTACTT
*GAACATCTTTTGATCCTCTTCAGTCAAAAGCTCACTGAGAAGAGG*ATGACTTAGAAACGCTGTCAGCCAAAAGTCTGGAATTGTTTTGATGATGTCAC
ACCTCCGAAGATAGACAGGTCTGCGAATCTCACTGTACTTCTGCTCAACCTCCAAAACCTTATCACTTGCTTCTTCATTAACCTTCTCGAGCTCGTCCTG
GATCTCCTGGAGCCTCTCGATGGAGAGGACGAGGGCACCGTCGATCTGCTCGTTCTCCTCGCCGACGTCGGTATCGGTCTTGGCCTTCTTCCCCTTGT*C
CGCCGGCGCCGTCATAGTCGCCTGTCtgcTAGGGTTTTAGCcctCCGACCTGCGCCGCGAGAGCGAGAGGGAGtgtgtgcgc
page-top