Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15587  (registered. 2002)
Contig Information
Length 701 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 2
Wh_r Root 6
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0674200 [Oryza sativa (japonica cultivar-group)] >gi|34393853|dbj|BAC83533.1| putative 60S ribosomal protein L22 [Oryza sativa Japonica Group] >gi|34395084|dbj|BAC84770.1| putative 60S ribosomal protein L22 [Oryza sativa Japonica Group] >gi|113612149|dbj|BAF22527.1| Os07g0674200 [Oryza sativa (japonica cultivar-group)] >gi|125559577|gb|EAZ05113.1| hypothetical protein OsI_27305 [Oryza sativa Indica Group] >gi|125601487|gb|EAZ41063.1| hypothetical protein OsJ_024546 [Oryza sativa (japonica cultivar-group)] >gi|215764943|dbj|BAG86640.1| unnamed protein product [Oryza sativa Japonica Group]
Score 467
Evalue 5.24509e-45
Total Hit Count 261
Registered year 2002
Contig Sequence     [ Download ]
>Contig15587
attcggcacgaggtgCGCGCCGCCACACGAACCCCCCACCCAACCCGAGCGAGCACCGGCCGAGG*AGGAAGAGGAAGGTGAGATGGCTCGCGGCACGGC
GG*CGACGGCG*GCGGCGGCTGCCAAGGGCAAGAAGAAGGGGTCCGTCTCCTTCGTGATCGACTGCACCAAGCCCGTGGAGGACAAGATCATGGAGATCG
CGTCGCTGGAGAAGTTCCTCCAGGAGCGCATCAAGGTCGCCGGCGGCAAGGCCGGGAATCTCGGCGACTCCGTCACCGTCACGCGCGACAAGAGCAAGGT
CACCGTCACCTCCGACGGCGCCTTCTCCAAGAGGTACCTCAAGTACTTGACAAAGAAGTACTTGAAGAAGCACAACGTGCGGGACTGGCTTCGTGTGATC
GCAGCCAACAAGGAGCGCAACGTGTACGAGCTCCGGTACTTCAACATCGC*TGAGAACGAGGGCGAGGAGGAGGATTAGAGTGCA*TTGTTATATTGTAG
TGCTTGTTGAGTTTTGATACTTGAT*CTGAGTACCTCCTAGTTATCCACCTATCTTATGTTGTGCT*CTGTTGAACATGAATGGTTTAATTTGAAGAATC
CTTATATTTTGCCT*CCCC*TTGACTGTGGGT*CCATATGT*CTGAACCTATAGACAAATATTATGGAGATTTGTtcccagTTTTCACCTgaaaaaaaaa
a
page-top