Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15545  (registered. 2002)
Contig Information
Length 774 bp
Clones 24 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_f Spike at flowering date 15
Wh_h Spike at heading date 6
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 1.57178e-83
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15545
gtCCTCCTCTCCTCCGATAATACAATACCATGGCCCCCGCCGTGATGGCTTCGTCGGCTACCACCGTCGCACCCTTCCAGGGGCTCAAGTCCACAGCCGG
TCTGCCCGTCAGCCGCCGCTCCAGCGGCAGCCTCGGCCGCGTCAGCAATGGCGGAAGGATCAGGTGCATGCA*GGTGTGGCCGATTGAGGGTATCAAGAA
GTTCGAGACCCTGTCTTACTTGCCACCCCTCTCCACAGAGG*CCCTCCTAAAGCAGGTAGACTACCTGATCCGCTCCAAGTGGGTGCCCTGCCTCGAGTT
CAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCTCCCGGGTACTACGACGGTCGATACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCACC
GACGCCACGCAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGATGCCTATGTCCGTGTCATCGGCTTCGACAACCTGCGCCAGGTGCAGT
GCGTCAGCTTCATCGCCTTCAGGCCACCAGGTTGCGAGGAGTCCGGCAAGGCCTAAACTACAAGTTGAAACAATGGCCTATGTATGATGGTCATTTGTGA
ACTTCACTTTTGT*CCACGACTCTGCTTTCCGACCAGAGCATATTTCTCGTTCCATATGAT*CTGTGTTTGTACGAACATAGGTTGTGGAGCATGCATAT
GTAAATT*CTAGCGAAAAATCTATACTGAAGTCGAGaggggctcggggctccgctgctaaccctaaaaaaaaaa
page-top