Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15538  (registered. 2002)
Contig Information
Length 697 bp
Clones 24 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 12
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.3 >gi|125524425|gb|EAY72539.1| hypothetical protein OsI_00404 [Oryza sativa Indica Group]
Score 434
Evalue 3.48267e-41
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15538
accaccacaagtTCAGTTCTAGATAGATATCAGTCTGCCAAATGCAACAACTTCAGTTCCTACAGCCAATCAGCCAACGAAGCGTTGGCGAGCACCCAGC
ACACAGACTACCAGCACTACTTGCAGAGTGACAAGCAG*AGTCGACACTACAGATACAGATACCAACTAG*AGGCGACGGACGCATCAGTCTAGG*AGGA
GGTGAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCGCCGGGGAGGACGAGGCGGACGGAGGTCTGGATCTCGCGGGAGGTA
ATGGTCGGCTTCTTGTTGTAGCGGGCGAGCTTGGCCGACTCCCCGGCGAGCTTCTCGAAGATGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGG
AGGAGATGCCGATGTCCGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATCTTGTACGTCTCCACGCTCTTCTTGGCCTTGCTGCCCTTCTTCCGGCC
CCTCGTCTTCGCCTCGCCCTCCTTGGCC*GCCGTCTTGCCCGCCGGCAGCCGCTTCTCGGCC*TTGGGCTTCTTGCCCGCGGGGGCCTTCTCCGCCGCCT
T*CTCGACCTTGTT*CTCCGCCGCCGGCTT*CTTGT*CTGCCTTGGGGGCCATGGCTGCTGCTGCTTCGG*AGGTGGGAGAGGGAGAggtgtttcgc
page-top