Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5264  (registered. 2012)
Contig Information
Length 896 bp
Clones alternative view 46 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195605420|gb|ACG24540.1|| DNA-directed RNA polymerases I, II, and III 14.4 kDa polypeptide"
Score 277
Evalue 1.00E-72
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5264
TTTTTTTTTTGATCCAACCCTAGCACTCTGGTTGATCTATTCAAGTCATCTACTACGAAACAATCTCTAATGCTACACCGAGCTAGAAATGCGAACACTA
AATAATCGACAGAACGTCCTGCACCACACCCACAAAAAGAGGTTAGGATAGGTGTTCATTCGCAACTTGTAGCTGCATGCCAGCAATGGTCCAAGCAAAC
TAACGCAACCACGCAATTGGTTTACAGTAGTAGCACAACACAATGGGCAGACATAGCCCACACATGTTACGATAGCATAACATTGTCACAGCAGTTCAGT
GCTAAACATTGCATATAGCTACTAGGGCAAGGTTTTGTTGCAGCACAGAGTCTTCCATTCAAACAGTCTACCAGCTTTAGTCCCCGCCAACCTGACGCTT
CCACGAGTCCTCCACAATGAGCTCGTCAACTCCCCAGTCCTCGTAGCTTCCATCAGGTAAGTACCGCCTAATCGTGAAGGGGATCTTGCGTGCTCTCAGT
TCTTTCATGGCAATCTCAAGAGGATCAGTTTCGCCCTCAAGCTCAACCATAACTGGGGCATTCATGCTTATCTGCAAAGCACGTGTGCCAAGGATGCGTG
CCCGCTCATACTTGGTCATATATTTTGTTGTATTGCGTGGACGGGCAGTCTTTTCCTGTTCCTTTTCTTCACCTTCACCCCCTACCACGTCATCAGGGGC
ATCCTCGTTGTTCTCAGGATCTTCTTCAACCCCTTCCTCAATATCAGCCTCTGGAGGCTCATCCTCGTACCCCATGTCAACTTCATTGTAGTCGTCGTCC
GCCATGGCTGCCGCCGCCGAGCGCTCCGGTCGCTAGGGTTTCGCCGCGGGAGGAAGCCTCGGGCGTGGGGATTGTGGTGGGTGTTCGCCCTCGTGC
page-top