Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15481  (registered. 2002)
Contig Information
Length 572 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_SL Seed DPA30 5
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 123
Evalue 2.49682e-05
Total Hit Count 84
Registered year 2002
Contig Sequence     [ Download ]
>Contig15481
ttttttttttcctctCGCCTTtccccaccTTCCTTCCT*CCCCCGTCGTCGCGGCTCCAGCTTAGGGTTTCTCGCCCCCGCCCTCCCGCCTCACCGCCGG
CCCCGTACGCCATGTCGAAGCAAGG*AGGGAAGGCCAAGCCGCTCAAGCAGGCCAAGGTCGCCGAGAAGGACTATGACGAGAATGACCTGGCATACCTCC
AGAAGAAGAAGGATGAGCAAAAGGCCCTGAAGGAGCTGAAGGCCAAGGCAGGCCAGAAGGGTGCGCTGGGAGGATCCGGTCTCAAGAAGAGTGGGAAGAA
ATGAGTC*TGCCCACCCTTACAAAATGCCCAGAAAATGATAATCT*ATCTATCTACCTATCTGTGTCGCGCTT*CACTA*TCTGTGGTTGTAAAAGACTA
CCTTCAGTTGTGTTGAGCATTAAGCATCGTCGCAGTCGGTTGCTGAAACCTATGGCATTTGAGCAGCCTCTTCTGCTTAT*CTGTGATGCAGATGGTCCC
TAGCTAATAATGACATGACTTGTTTTGTGATGAAAATCTCTAATGTGTGCATcaagtcttccaaaaaaaaaa
page-top