Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15466  (registered. 2002)
Contig Information
Length 783 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 4
Wh_r Root 4
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194703792|gb|ACF85980.1| unknown [Zea mays] >gi|195615288|gb|ACG29474.1| 60S ribosomal protein L18a [Zea mays] >gi|195627346|gb|ACG35503.1| 60S ribosomal protein L18a [Zea mays] >gi|195627434|gb|ACG35547.1| 60S ribosomal protein L18a [Zea mays]
Score 905
Evalue 1.06648e-95
Total Hit Count 303
Registered year 2002
Contig Sequence     [ Download ]
>Contig15466
tagattgtatgcagattactgataag*aacacaat*cACAAGGTTCACCGACCATGTCTTTAAATGATAAATAAGCAACAAAACACTAGTCTTCATGCAT
TAGAAGATCCAACATACTAAGAGAACATTTCAACTTTTGTGCTTCTGCCCAACAAAAATACCAGCATCCACCACA*GCCCAATCACATGAACAGGTTCGG
CCTCGTCGCCTTGTAGGTGGTCTTCAGCTTCCTGGTTGGTGGCCTGACCTTTTGGTACACAAGGGGGAACTT*GATCTTGGAGTTGTGGAACTGCTTGGT
GTTGTCTCTCTTGCATAGCTTGAAGTTGACAGTCGCGGTCTTGATGATCTGAATGCAGGGGGATCTCACACGGTGGCGAGAGGCCATCTCAGTGTACATC
TGCTCCACGGCACCATTCAGTGTGGTGTCACGGTACTCCTTGTACATGTTGTGGTAGCCGGTTCTGCTCTGGTAACGCAGCCAAATGCCATAGTTCTTGA
TCGTGGTTGGG*TTCTTCTCAAAGATC*TCGTTGATGGCGAGCAT*CTAGCCGTTGCTCTTCTTCACCTTCTTCAGCTTCCTCAGGAAATACCAGAACTT
GCTCTTGGCGCGCACCTCATTGGTGGCCCAGAGCTTCATGCGGTAGATCTTAGGCTGCTCATCGCCGGGCGTCGGCAGCGCGCGACCCACCACCTGGTAC
TGATGGAACCTGAAGGCCACCATTTCC*GCGAGCTCTGCGAAGCCCCTAGCCTAACCTAACCTAAGCAGATGGGGAGGGCagc
page-top