Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15463  (registered. 2002)
Contig Information
Length 825 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 10
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Medicago truncatula]
Score 452
Evalue 8.21667e-72
Total Hit Count 385
Registered year 2002
Contig Sequence     [ Download ]
>Contig15463
tcgaattccggTAACACAGGCACATAG*CAAATAGTTCAACAGACATGCCTGGAGGTTCAGCCACAGAACGAAGGTAGCAAAATTTGACGGTGCAAACAG
ATACTATCAAGGTAAGCATAGGGCAGGTTCCACAGAACATAACAGCACATAAGCTTAACGGTAGCGGCGGAGGGAGACGGTCTGGTTCCTCTTCCAGGTG
GCTCTCCTTGAGGGCCTGTTCTTGTGGTGGCGGTGACCCTTGCCACGCAGACCA*CGGAATTTCTTTCCCGCAGAGGTGAGACCACGCAGCTCACGGTGC
TTGTGCACAGGCTTGCAGAGCCAGTTGATCCTTGGATCGTTGCGGACAGCGCTGTGAGCAACGTCAACAAGGATGACCTCAAAGTACTTGTAGGTGGAGT
CCTCATTCACCCAGTAGGAGTTGAGGACACGAAGACCACCAAGCCTGCGCCCAGCTCTTTCCTCAGCAACAGACCTCTTGTTCCTCTGGAACTTGAGTTG
GGTAATACCCCTGGTGCTTAGGCTTGCCATAAACAATACCCTTGGGCACTGGGCGCTTCCTGCCACCACGTCTCACACGGATACGGTAGACCACATACCC
CTGCTTGGCCTTGAAGCCGAGACGGCGTGCCCTGTCGGGG*CGGGTGGGCC*TGGTGATGCGGACGATGGCGGGCTGCT*GCCTGTACTCCCAGCAACGC
ACGCGCTGCACGAACCTCATCACGTCGGACTGCTTCCTCCTCCATAGCTCCGACACGAACTTGTACGCGCCCATGGCTGCGGCTGCGGCGGCAGAGGGCG
GAGGCGGCGGGAAacggagcctcgt
page-top