Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15455  (registered. 2002)
Contig Information
Length 660 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 12
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0634500 [Oryza sativa (japonica cultivar-group)] >gi|115488728|ref|NP_001066851.1| Os12g0508300 [Oryza sativa (japonica cultivar-group)] >gi|31745220|gb|AAP68880.1| putative ribosomal protein S29 [Oryza sativa (japonica cultivar-group)] >gi|77552059|gb|ABA94856.1| 40S ribosomal protein S29, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113645547|dbj|BAF28688.1| Os11g0634500 [Oryza sativa (japonica cultivar-group)] >gi|113649358|dbj|BAF29870.1| Os12g0508300 [Oryza sativa (japonica cultivar-group)] >gi|125535057|gb|EAY81605.1| hypothetical protein OsI_36775 [Oryza sativa Indica Group] >gi|125577778|gb|EAZ19000.1| hypothetical protein OsJ_033209 [Oryza sativa (japonica cultivar-group)] >gi|149391293|gb|ABR25664.1| 40S ribosomal protein S29 [Oryza sativa (indica cultivar-group)]
Score 321
Evalue 4.01028e-28
Total Hit Count 332
Registered year 2002
Contig Sequence     [ Download ]
>Contig15455
ttttttttttaaatAAAGTAAGCATATTCGCTGGGTTGCTGGTCTTCTACAGAAATTGAGCCAATACGTTCTAATAAAAAACAAGTACTTAAAACTACCA
ATGACAATGAGAGGAGACAAACACAGGCAACAGAATGATAAAAGGCTACCCCATGGGTAATTAACTCATGTTCAACAATTACATCATTCAGTATCCATCA
AAATATAAAGCCACTCTCAGAGTACTGAGCAATCATTACTGGAATTGAAATTAAGCCTTCCATTAAGAGTTCCATTACTTCATCCCTGATTAGCTTCACT
TCAGGGTAGCAGGACCAGGTGAATTAACGGTACTTGATGAAGCCAATGTCCTTGGCGTTGCTGCGGAAACACTGCCTGCAGCACATCAGCCCATACTTCC
TGATCAGTCCATGGGAGTTTCCACAGACCCGGCAGACGCGGGAGCCGGGCCCGTAGTTCTTGGGGTGGGAGTTCCAGACGTTGGAGTGCCCCATCGTTGC
CGCCTT*CTTGTTCGCCTTCCGCCTGCCGCCGCCGGTTGCTAGGATGCGCGTGTGTGTAAGGTTGGAGCTATACTATCTGCGATAAGCTAAATCTTTGGT
TTAGATTGTTTTTTTAGGGAAAAAACTTCCAATCTAATTTCTATTCATCTTCAAAAAAac
page-top