Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15437  (registered. 2002)
Contig Information
Length 992 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_dL Crown of seedling 5
Wh_oh Pistil at heading date 4
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195605546|gb|ACG24603.1| proteasome subunit beta type 1 [Zea mays] >gi|195659171|gb|ACG49053.1| proteasome subunit beta type 1 [Zea mays]
Score 925
Evalue 8.78119e-113
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15437
atttattccgggtaatcatagaatggctatgaacgtacttttagcatttccaacaaatagcTCAGCATCTCATATGCATGAAACAACAA*AGTAGTTTAA
CAAAGCAAG*CTGGGTCGATCCTGGTACAT*CATCACGGAAGCAAAGCAAGCACGGGCGTTTCTATCAAGTAGCAGCTCTGGGCATAATAATTCCCTATA
TCTAGGGAAGCAAATGGCAACCGCGGCGCAAACTTAGTCCTTCCTCAACTCGATGTACTCGCGCCTCGTCCCAGCTTTGTTAATGACTACAATCTCCACC
TTGTCCCCGG*TGTAGATGTCCCTCTCAGTTGCAGATGCAAAGACATCCTTAACTAGGTCGACCGCCTCTGACTCGGACAAAGGGGTGACGGCATCTCTT
GCAGGGACTAATAGTGGACTAGGTGATTTCAGCTGGTTGTCCAGCACTGGCATGATCAAGGTAGACCCTGATCCCTGAGCACTGTAACCAGTCCTTTCAT
AGGACCCAACAGCATCATAGGAGTAGACACATCCTTTCCCTTCACTGTCAAGCCC*ACCAAGCACGTT*GAAAGCATAGTATGGGAAGAATCTCTT*GTA
GTACAGGGTGTTGGAGAGCAATTGTGCCATTGCTGGGCAGCTCATCCTTTTATTGTGCTGGTGCTGGTATAGCAGTTCTCTGGCAGCTAAGTTCTTCTGT
AGAGCTTTGATGTCACCTTGGAAGCCAGAAGATGCTATTACACATTTATCGGCCAGCTCGCAGATCTT*GGAGTGCTCGCGCGTGAGGATGTTGTATCCG
ACGGAGAGGccgGGTGTCGGCGGCGACCACGCAGTAGTCCGCGCCGGCGATGGCCACGCAGGTCCCGCCGTTGTTCTCGTAGACCCAGTCGCCGCGCCTC
GACATGGCGGTGGTCGGAGAGGGCGGGCTGCTCGGGGGGCTGGTGGTGGAGTCGCCGGAGTTCG*GGCTTGGAGGAGAAGGCGAAGTGGAgc
page-top