Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15422  (registered. 2002)
Contig Information
Length 961 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 2
Wh_h Spike at heading date 5
Wh_r Root 5
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ADP-ribosylation factor [Oryza sativa Japonica Group]
Score 905
Evalue 1.53084e-95
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15422
caattaatcTTGCTAAAACTCAAAACGATAGGGGTTCAGACACACATTGTCGACACATTAAACCTTGTAAAACCACCGAACAGCAACTGATAACATCCAT
GCAAAAAAAGACAACCTGACCTGATACTAGCTCACTTAAAGAAGGGAGCTTCTGCCTGTCACATACGCACACATACTATCTCTTGTACAGTGTATATATA
TCACAATATGTAAAATGGTAGCAGTGAGTTGTTGAGACATCCAGCACGTTTGTTTCTTGATGAAGCGCTTGTCGAGGCGCTTCAAGCCTTGTTGGCAATG
TTGTTGGAGAGCCAGTCAAGACCCTCGTACAACCCTTCGCCAGACGTCGCGCAAGTGCTCTGAATGTACCAGTGCCGCTGGCGCAGGGAGTGCAGACCAA
GCTTGTCGGTGATTTCAGCAGCATT*CATGGCATTAGGAAGATCTTGTTTGTTTGCAAATACAAGCAACACAGCATCACGCAGCTCATCCTCATTCAGCA
TTCTGTGGAGCTCATCTCTAGCCTCAACAACACGTTCCCTATCATTGCTGTCAACAACAAAAATGAGCCCTTGGGTATTCTGGAAGTAGTGCCTCCACAG
GGGCCTGATCTTGTCTTGGCCCCCCACATCCCAAACAGTGAAGC*TGATGTTCTTGTATTCAACAGTTT*C*GACGTTGAATCCGATGGTTGGGATGGTG
GTGACGATCTCTCCGAGCTTGAGCTTGTAGAGGATGGTGGTCTTACCAGCGGCATCGAGACCAACCATGAGAATCCTCATCTCCTTCTTGGCGAAGAGGC
GGCTGAACAGCTTGGTGAACGTGAGCCCCATCTCTGCTCCGAGGTGGAGACGAAGGCTTCGAGGT*CTCGGCGCT*CCGGTGCGGCGTGCTCCTCCTGAT
*CTAGGGGGAGACGGGCGTGGGAGTTGGAGCTTGGAACCGCACGGAGGATgaggctgtcgc
page-top