Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15399  (registered. 2002)
Contig Information
Length 1811 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 7
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_21076 [Oryza sativa Indica Group]
Score 2396
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15399
cccccgggctgaggaattcggacgagggcggccccggccaggtcggcGCCgccatgCCGTCGCTCGACTTCGACACCGCCGTCTTCAACAAGGAGAAGGT
CTCCCTCGCCGgccacgAGGAGTACATCGTGAGGGGCGGGCGGAACCTCTTCCCGCTGCTCCCGGAGGCGTTCAAGGGCGTCAAGCAGATCGGCGTCATC
GGATGGGGCTCCCAGGGTCCGGCGCAGGCCCAG*AACCTGAGGGATTCCCTGGTGGAAGCCAAGTCTGACATCGTCGTCAAGATTGGCCTCAGGAAAGGT
TCCAAGTCTTTTGAGGAAGCACGTGGTGCTGGATTCACCGAGGAGAACGGAACCTTGGGAGACATATGGG*AGACGGTCTCTGGCAGTGATCTTGTGCTG
CTGTTGATTTCAGATTCTGCCCAGGCAGACAACTATGAGAAGATCTTCTCTCACATGAAACCAAACAGCATTCTTGGTTTATCTCATGGGTTTCTCCTTG
GTCATCTGCAATCACATGGCCTTGATTTCCCCAAAAACATCAGCGTCGTTGCTGTGTGTCCCAAGGGGATGGGCCCGTCGGTTCGGAGACTGTATGTTCA
GGGCAAGGAAGTAAATGGTGCTGGCATCAACGCTAGCTTTGCTgttcaCCAGGATGTTGATGGAAGGGCCACTGATGTTGCTCTTGGGTGGTCGGTTGCA
CTAGGATCCCCGTTCACCTTTGCTACTACTCTAGAACAGGAGTACAAGAGTGATATCTTTGGGGAGCGAGGAATTTTGCTGGGCGCTGTCCATGGCATCG
TGGAGGCTCTGTTTAGGAGATACACGGAGCAAGGAATGGACGAGGAGCTGGCATACAAAAGCACCGTGGAGGGCATCACTGGAATTATCTCTAAGACCAT
CTCAAAGAAGGGGATGCTTGAGGTGTACAACTCTTTGAGTGAGGAAGGCAAAAAGGAGTTCAACAAGGCATACAGCGCATCATTCTACCCTTGCATGGAC
ATACTCTATGAATGCTACGAAGATGTTGCCTCTGGAAGTGAAATTCGGAGTGTTGTGTTGGCTGGTCGGAGGTTTTATGACAAGG*AAGGTCTTCCTGCT
TTCCCTATGGGCAAAATCGACCAAACTCGCATGTGGAAGGTCGGCGAAAAGGTGCGCTCGACCCGGCCAGATGGTGACCTTGGCCCACTCCACCCCTTCA
CGGCTGGAGTTTATGTCGCACTTATGATGGCCCAGATCGAGGTGCTGAGGAAGAAGGGG*CACTCCTACTCTGAGATCATCAACGAGAGCGTGATCGAGT
CGGTGGACTCGCT*GAACCCCTTCATGCACGCGCGCGGGGTGGCCTTCATGGTGGACAACTGCTCGACGACGGCGCGGCTGGGGTCGAGGAAGTGGGCGC
CCCGCTTC*GACTACATCCTGACCCAGCAGGCGTTCGTGACGGTGGACAAGGACGAGCCCATCAACCAGGACCTCATCAGCAACTTCATGTCGGACCCCG
TCCACGGCGCCATCGAGGTGTGCGCCGAGCTGAGGCCCACCGTCGACATCTCGGTGACGGCCGACGCCGACTTCGTGCGCCCTGAGCTCCGGCAGTCCTC
CTAGGCTCCTCGCCCCCTTGCACCTAAGTTAAGTAAGCTGCGCCGGGCCGGTTGGGGCCTGGCACGAGAGTTGGTTTTTGATGGATGGACATTCATGGAC
TGTAATGTATGTGTGCGACTGGCTGTTTGAACTCGTGAGCTGCTG*CTGGGTAGAGTGAGTCGTCTTCGTTTCCGGAATAATAAAgttagttcgtccggt
taaaaaaaaaa
page-top