Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15376  (registered. 2002)
Contig Information
Length 1072 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_SL Seed DPA30 3
Wh_e Seed DPA10 4
Wh_oh Pistil at heading date 2
Wh_yf Spikelet at early flowering 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_24464 [Oryza sativa Indica Group]
Score 933
Evalue 1.02909e-98
Total Hit Count 123
Registered year 2002
Contig Sequence     [ Download ]
>Contig15376
ttttttttttaagatcagaaatcccataGATAACATATAC*CTTCAACAA*AATTGTGTTTCAAGGAAAACTATCTGTAAAGTACACAGCAAGGTCGAAA
ATGGTGTCAACAAG*ATGTGCAGCCACG*AGACTAGTTCAAACACCTCCGCTCTCTCATCTATCCAGGTTACTTGTGAAGGGCTACCCTCGATTTGTCTC
ATTCTAGATCCTGAAATGTCTAGCTAGGCCCAGCAACCTCGAATCTATTTGTTTTTCTTGGCTTTGTCCTTTGCAAACGCGGTACCCTCCAGCCACTCGT
CCATGTTGGCATCAGTTGTTCCAGTTCCGAGTTCCACCTTGGGGCCTTTCTTTGTTTTCTTCGAGAGCTGTTGCACTT*GACCATAAGCCCACAATCCTA
GGAGACCAAGAAGTGCAATTCCAAGGGTAATAAGGAACACA*GATTCAACACTCAGTAACCCTCCGACCTCAACAACCTCAATGGTGCCGTTGTAGAAGA
CGTTCTGATAAGGGTGCTGATCAATCTCGTACACAATGTAACCAACAAGATCATATGCTCCAGGCTGCAAGAATTTGCTCACGGCAAATGTATAGGGAAA
GGTTGCTTGCACAGAGACAGGAACTGATGCATTGTAGAAACTCTGAACTGTAAGG**TTTTGTCCATACATTTT*ATGATCATAAGGAAGGTGTAGGG*T
TGAATGGACAGCAACAACATTCAAAGTTGATTCACCCTCATTTTGCAGGCCAACCAACAGCTCAGTTTCTTCACCCGCTGGTACAATTTTCCCAGCATTT
TTGGGGAAGACGCAAACAGTCTCCACACCAGGAGCAGGGCTTAAAGGCTCTTCACTGGAAACCGGAGTATCATCACCCACATATCCTAGATCAGCCCCAT
CAACAACTTC*TTGCATAGCAGCATCTTCCTCAGACTGAGCTCTGGCAACTTGGGCGAAGGGGGAGGCGGCGAGGAGGAAGGCGAGGAGGATGGCGGAGA
CCCAAACCCTAACCGCCATGGCCGGCTCAGTCAGATCGGATCAGGAggacggagggaggaggtggtgctgcc
page-top