Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15363  (registered. 2002)
Contig Information
Length 786 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 3
Wh_oh Pistil at heading date 2
Wh_r Root 6
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100192679 [Zea mays] >gi|194691302|gb|ACF79735.1| unknown [Zea mays] >gi|195605366|gb|ACG24513.1| nuclear transport factor 2 [Zea mays] >gi|195605650|gb|ACG24655.1| nuclear transport factor 2 [Zea mays] >gi|195605666|gb|ACG24663.1| nuclear transport factor 2 [Zea mays] >gi|195611100|gb|ACG27380.1| nuclear transport factor 2 [Zea mays] >gi|195618194|gb|ACG30927.1| nuclear transport factor 2 [Zea mays] >gi|195622818|gb|ACG33239.1| nuclear transport factor 2 [Zea mays] >gi|195644142|gb|ACG41539.1| nuclear transport factor 2 [Zea mays]
Score 552
Evalue 9.35279e-55
Total Hit Count 418
Registered year 2002
Contig Sequence     [ Download ]
>Contig15363
agggaagaaacttttgggacatgcaaaagtgaacttaaatggtcacAAACAAAACCCAG*AG*ATGCCACGCATAACTAATACCTGGACGGTTTCCATCA
ACATTCCAAAGAAAGTGCCACCCAAGCAACGACAATACATGGGAAACACAAAACAAAAGATGATCTGGTGGATGCCTATCAAGGCAATTTTTTGCGATAA
ATTGCACAGGTTGGCGAACAAACAAAGAGTCTGCAGCATCATCATTTGATGTTCATTGTTTCAACATAAATCCCTGAACAAGTTCTTTGCTGCCAGAGTC
GCCCTTCCTTAACCATAGTTCAGGCGGAACATGTCGTTCTGCACGTAGAAGCTCCCTCCAGCTGGCAGCAAATGGAACATCTGTGAGAACTTGAGGGGGT
GCTCGCCGGGGCC*GGTGGTGATGGTGCCGGAGACGAAGACGAGGACGCCGCCCTGGGGCCCCGAGGGCTGGCAGTCGACGGTGTCGATCTTGTGCTGGC
ACTGCTGGAAGGGGAGAGATCCGAGCTTGCCGGCGATGGCGGCGGGGCCGCCGAACTTCTCGCCCTCGAAGGTGAGCATGGAGCCGTCCTGGTACAGCCC
CACCAGCGCGGCGCGGTTGGAGTCGAACGTCTGGTAGTAGTGCTGCACGAACGCCTTCGACACCGAATCGGGATCCATGGCCTCTCCCTCGCCGCGCCGC
CTCCTCGCCTCGCCTCGCCTCGCCTCGCCTAGGGTTTGGAGCT*CTGGATGCGGAGGCTTTGGGCGTTGGGAGCC*GGAGTTtggc
page-top