Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15361  (registered. 2002)
Contig Information
Length 1145 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_e Seed DPA10 4
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_025258 [Oryza sativa (japonica cultivar-group)]
Score 1437
Evalue 4.10941e-157
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15361
ccgcatgttcgtcgagacggaagaggctgcccttttattacat*CAT*CACACACAG*ACCATTGCTACTACACAAGG*TTTGTTTTATTACAATCACAC
AGACCATTGCTAACA*TAAGGTTTGCCTCCTCGCGACACAATTTGAGCCTGCTCGTCTTCAGTGGAGTTCCTTGAGGAAGTCCGCATGATCCACCAGAAC
CACTTTCCAGCCATCTGGGTCAAGGAAAGAGGTGATTTTGGTGTTCAGCCCTGGCAGTGGCCCTGGCTGCCTTAGAATCTTCCCACCTAGTTCTTTGGTA
ACCAGCTCAACTGCTTCGGCGCTCTTGTACACATCGTCAGTGCCAATAGCAACCTGAGCATATGCATTGCCCTTGTTATATTCCGTGACACCATAGTTGT
ATGTCAACTCCAGAACAGTGGTCTTGTCCTCCTCAGCATAGCCCATCATGGCAATAGTGTACTTATACTGAGGCACAT*CCTTCTTCCTCAGAAGCTTCA
TCCCAAGGGCCTTCTCGTAGAACATGATAGCCCGATCAAGGTCACCAACACGAAGCATAACTTGACAGAGAGGCTCAGGCGTCGGACCCCTCTGGATAAG
CTCAAACATGTAACCATCTGGGTCTTGTGCAAAGGCAATCACAGTGGACCCTCCCTTGACAGGACCAGGTTCACGAGTGATCTTACAACAATCAGATGAT
TTAATTGTCTCAGACAGCTTGTACACATCCTCATTTGCGATGGCAAAA*TGTCCAAAGCCCGCTCCAATGTCATACTTGTCAACACCAT*AATTGTAAGT
CAGCTCAAGTGCAAAATTAGTATCCTCAGGCCCATATCCAAGAAACGCATTGGTGTACTTCTCTTCTGGGACATCTCTTTTCCTCAG*CAGCTTCATCCC
AAAGCATTC*TGTGTAACACTTAATTGTGCGGTCGAGATCTCCCACACGGTAAACAGCATGCAGCATCCTCTTTTTGTCCTGCTTAGGCCATTCCAACAC
TGCCTCAGCAGACTTTCCAGCTTCGCTACCGGTAGCCAT*CCCTGCTGTCACCCTGGAAATACGATCGGGTAGAGATCCGTCCCACGCTGATGAGGAGCT
CAGTCTAGAGGCTtcccaggagaagagagggggggggaggggggc
page-top