Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15349  (registered. 2002)
Contig Information
Length 1126 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 4
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_24464 [Oryza sativa Indica Group]
Score 915
Evalue 1.37309e-96
Total Hit Count 118
Registered year 2002
Contig Sequence     [ Download ]
>Contig15349
tttttttttTGCTGACCTCCAAACATACTTTGGCTAATGCCATAAGTGTATGCCAAACCACGCAGCTCTAGGATCAAAGATCAGAAATCCCATAGATAAC
ATATACCTTCAACAAAATTGTGTTTCAAGGAAAACTATCTGTAAAGTACACAGCAAGGTCGAAAATGGTGTCAACAAGATGTGCAGCCACGAGACTAGTT
CAAACACCTCTGCTCTCTCATCTATCCAGGTTACTTGTGAAGGGCTACCCTCGATTTGTCTCATTCTAGATCCTGAAATGTCTAGCTAGGCCCATCAACC
TCGAATCTATTTGTTTTTCTTGGCCTTGTCCTTTGCAAACGCGGTACCCTCCAGCCACTCGTCCATGTTGGCGTCAGTTGTTCCAGTTCCGAGTTCCACC
TTGGGGCCTTTCTTTGTTTTCTTCGAGAGCTGTTGCACTTGACCATAAGCCCACAATCCTAGGAGACCAAGAAGTGCAATTCCAAGGGTAATAAGGAACA
CAGATTCAACACTCAGTAACCCTCCGACCTCAACAACCTCAATGGTGCCATTGTAGAATACGTTCTGGTAAGGGTGCTGATCAATCTCGTACACAATGTA
ACCAACAAGATCATATGCTCCAGGCTGCAAGAATTTGCTCACGGCAAATGTATAGGGAAAGGTTGCTTGCACAGAGACAGGAACTGACGCGTTGTAGAAA
CTCTGAACTGTAAGGTTTTGTCCATACATTTTGTGATCATAAGGAAGATGCAGGGTTGAATGGACAGCAACAACATTCAAAGTTGATTCACCCTCATTTT
GCAGGCCAACCAAAAGCTCAGTTTCTTCACCTGCTGGTACAATTTTCCCAGCGTTTTTGGGGAAGACGCAAACAGTCTCCACACCAGGAGCAGGGCTTAA
AGGCTCTTCACTGGAAACCGGAGTATCATCACCCACATATCCTAGATCAGCCCCATCAACAACTTCTTGCATAGCAGCATCTTCCTCAGACTGAGCTCTA
GCAACTTGGGCGAAGGGGGAGGCGGCGAGGAGGAAGGCGAGGAGGATGGCGGAGAGCCAAACCCTAACCGCCATGGCCGGCTCAGTCAGATCGGATCAGG
*ATGGAGGGAggaggtggtgctgctg
page-top