Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5247  (registered. 2012)
Contig Information
Length 1375 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|38345936|emb|CAD41413.2|| OSJNBb0078D11.11 [Oryza sativa (japonica cultivar-group)]
Score 605
Evalue 3.00E-171
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5247
CATAGCAAAACCTGCTGCCTCATGGCTTGATGACTTCCTAATATGGATGTCTCCCGAAGCATTTGGATGCTGTCGAAAATTTGTTAATGGAAATTATTGC
CCTCCAGATGATCAGCCTCCTTGCTGTCAACTTGATCAAGATTCAGGTTCATGCAGTTCAAATGGAGCGTGCAATAATTGTACAACGTGTTTCCTACATT
CGGACTTACACAATGGGCGTCCATCCACAACACAATTTAGAGAGAAACTTCCATGGTTTCTGGATGCACTGCCATCAAGTGACTGTTCTAAAGGGGGAAA
AGGAGCTTATTCTACAAGTTTGGACCACAGTGGTTATGAAAATGGCATTATACAAGCATCAGCGTTCCGTACGTACCATACTCCCCTTAATAAACAGACT
GACTATGTTAACTCATTGAGAGCTGCTCGGGACTTCAGCTCTCAAATGTCCAAAGATTTACAGATGGAAATTTTCCCATATTCAGTGTTCCATATATTTT
TTGAGCAATACCTCAGCGTATGGAAGACAGCCATCATGAATATATGTGTTTGCCTTGGTGCAGTATTTGTTGTTTGTTTCGTAGTCACCAGCAGTTTGTG
GGCTTCAGCAATCATTTTGATTGTTCTGGCCATGATAGTCTTGGATCTGATGGGAGTGATGGCTGTCCTTGGAATTCAGCTCAATGCAATTTCTATTGTA
AACCTTGTTATGTCGATAGGAATTGCTGTTGAATTCTGTGTTCATATCACACATGCCTTTATGATAGGCATCGGGGATAGAGAGAACCGTGTAAGGCAGG
CTTTATCGACGATGGGTGCTTCTGTATTCAGTGGAATTACCTTGACCAAACTTGTAGGAGTTATTGTCCTACGTTTTGCAAAATCTGAAGTTTTTGTGGT
GTATTACTTCCAAATGTACCTGGCACTCGTCCTCATTGGCTTTCTGCATGGGCTTATCTTCCTACCGGTTGTGTTGAGTCTGTGTGGCCCTCCTCAAAAA
ACCATGAAACCGATCGAACAAAGTCAGACTCCGCCTTCAAATGAGCAAACTTGATAAGTACATAATATTCTGGGATTTTTACAAAGCATTTCAGTGTACA
TATCCATCTGTTACCCCGGTGCTGGAGGAACTGTGAGGGTGTAGATCATTTATAGAGGCGGGGTAATCCCTATAGAAAGATAGGCTGTACATTAGTTAAG
TTTACTGAATCAGTACTAGTTTAGTCGATATCGCCGCGAGAAGCGTGAGAGATGTTTGTAGACCAGTGTAGTAGCTTGTGTTTCTTGTGTCAGCTACTAC
TGCCAGTTCTATGCCTTCTGGTTTGTACTTGTTTCGTGCGAGAAACCAATGTCATGTTTGGTGCCAAAAAAAAAA
page-top