Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5246  (registered. 2012)
Contig Information
Length 698 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242047490|ref|XP_002461491.1|| hypothetical protein SORBIDRAFT_02g003480 [Sorghum bicolor]
Score 175
Evalue 4.00E-42
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5246
GAAGAAACGAACAAGAGCTACTGTGTGGTAGACGTTGCACCACCCTGGTTCATATCATTCTTGAAACCAGTTCTTTACAGCTGCATCTTTGGTTGCACAA
ATCAAACATGTTACATGTGACTGTTCTAATAGTACCAGATGCCAGGTTCAACTCGCAGCTAAAAAATAAGTTCATCTTTCATGGTAGAAGATGGTTCATT
GTGAACCAGATCTCGACGCACAAGTTGCCGAAGACGAGGCGCCATTTACGGAAGCACAAAAGTTGGACGACGCGGCCCCCTGATTATTTGTAGCAGAAGA
AACATTGTCCGAAGAAGCCGATGAGGGCCCAGAGCCACTCCCATCCCTCGTTTCTAGCCGCTCCATCATGCGAGACACAGCAGCGATTCCGGCATTAACC
TCCCTCCTCACATCAGAACCAAGACTCGATATCGTGTCACTCCGAGAGAGCCACCGTTCCTTCCACCCACGGGTGTTCTTCGTTATCGAGTCCTTGTACT
TGACCGAAACCGACTGCAGGCGAGTCTTGAGTGTGTTTGAGAAAGATTGTGGATCGGATGGTCCAGCTCCATCCTGGTTGATGGGAGATGCTTCATCACC
AGAAATTCTATCATTTGATCCAACAGGGCAGTTAGATGAAGTATTATTGTGCACTAGTATGTTGGCAGATGCTTCTTCCATGGCATCCACAGGAGCAG
page-top