Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15303  (registered. 2002)
Contig Information
Length 947 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 5
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 3
Wh_r Root 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1047
Evalue 5.14646e-112
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15303
caaacttgatgaaaaaacACATTGGATTCTGTAATGATTT*AGCAA*AACAGG*C*TACAAAGTTCGTTCATGGGATACAACGG*AAAAACCTCCTCAGG
CAGCACAGGGGCCCGAGGATTTGATTATAAGTAAG*ATCTACAG*ACGGGG*TGGCGCAAACATGTATCGGAAACTTAACAAGACATGAAGATTTACTAA
ATTCTTATGGCCGAGAGAGAAAATGTGGATGCTTCTCCTGCAAAATGCAAACTATAAAGAATGAATCACGGTCAAACCACTTCTTGCTCTTCCTCCGATC
CGGCCGGCCGACGAGGTGAACTTAGGCCACGGCGGGCATGTCCTTGAGCCAGCCGTCGAGCGGCTTGCCGATGGAGTAGACGATGAAGCCGATCTCCCTG
AGCTTCTCGGCGTCGACGACGTTGCGGCCGTCAAACACGAAGGCGGGCTTCTGCATGTTGTCGAAGATCTTCTGGTAGTCGAGCTTCTTGAACTCGTCCC
ACTCGGTGAGGATGCACACGCCGTGGGCGCCCTTGGCGGCCTCGTAC*GCGTCCCACACCACGCTCACCTGCTTCACC*GCCGTGGGGCTGGTCGGCTGC
AGGTGCATCGGGTGGTCCCAGTCGAACTTGTTCATGGCCAGGTCCCGCTGGATCTGATCCTCCGTCACCTGCGGGTCGTAGATGCTCACCTGGGCCTTGT
CGCCCACCAGGCCCTTGCACACGTCGATCGCCGGCGTCTCCCGGGTGTCGCCCGTGTCCTTCTTGAAGGCGAACCCGAGCACGGCGATCTTCTTGCCGGA
CACCGTGTTGAACATGGACGACACCACGCGGTTCAcgaaccggctcttctggtagtcgttgatcttgatcacctgcttccagtagttggccacctccggc
aggccgttgcactcgcagatgtacaccaggttcagcctcgtgccgaa
page-top