Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5244  (registered. 2012)
Contig Information
Length 668 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 3
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XB Root 6
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115449569|ref|NP_001048498.1|| Os02g0815000 [Oryza sativa (japonica cultivar-group)]
Score 189
Evalue 2.00E-46
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5244
CATATTGAAACAACAAAAAACAGACTCGTCACAAATAGCACATTGAACAATAGATGCAGCATCTAACACAGGACATCGACACAATTCAACATTCAAAACT
GAAGGATTAACGTCCACGACAATTGTGCAAATAACATAACCAGGCATCATATAGTCTGCCTCTCAACATAGAAACATAAGAGTTCCAGTAGAAAACAACA
AAAAAGCTAAGTTTGATGATCAGGGCTTCGCTTAGGGCAACAAATGGAGACTGTCACGCCTAGTTGCCGCTGGAAGAGGCTCCCTTGCTCCTTGGTGCGG
CCTCAGTTCCCTCTCTGAAGTTGCTCTTGAACCTCCTGGGCACATGGCGCATGTACCTCATCCTCCCGGTGCCGGTGGTCTTCCTCCTGATGGCCTTCAC
ACTCCAGTTGTACTTGCGGATGCGGGCGGCGGGGTAGCCGCACGAGGAGCAGGTGCTCTTCTGCAGGTGGAAGCTGCGGCGGCCGCAGCGGATGCACAGC
GTGTGGGTCTTGTTCCGGCGCTTGCCGAAGCTGCCCGTTCCCTTCGTCATTTCGCCTTCGCCTGTCGCCTCCGCGCCGCCTGCGCCGCCGCCGAGGGAGG
AGGAGAGGAGGAAGAAGAGAGCCGTGGGGCTTCGAAGTTGGCACGAGCATGATCTTGCCCTATCACTA
page-top