Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15296  (registered. 2002)
Contig Information
Length 1607 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_r Root 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Eukaryotic initiation factor 4A; Short=eIF-4A; AltName: Full=ATP-dependent RNA helicase eIF4A
Score 2108
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15296
gctcggtTTTTCTCTCTCCTGCCAATCCCCTCATCGCCTCCGCTCCCACGCCGCCGAATCCGAG*ACCTGATCTCGGATTCACCGCAGCGACGCGACCAA
ACCCTCAGGCGATCCCCGGCACCTCCTCCCCGACGCTTCAGCCATGGCAGGAATGGCACCGGAAGGTTCCCAGTTTGACGCTAAGAACTATGATTCTAAG
ATGCAGGAGCTGCTGAGCCAAGGTGAGACTGAGGAGTTCTTCACCTCCTATGATGAAGTTCATGAGAGCTTTGATGACATGGGTCTCCAAGAGAACCTCC
TCAGAGGAATTTATGCTTATGGTTTTGAGAAGCCTTCTGCCATCCAGCAAAGGGGAATCGTTCCTTTCTGCAAGGGGCTTGATGTTATCCAGCAAGCACA
ATCTGGAACAGGAAAGACTGCTACTTTCTGTTCTGGAATCCTTCAACAGCTTGACTATGGTTTGGTTGAGTGCCAGGCCTTGGTCCTTGCTCCCACACGT
GAGCTTGCACAGCAAA*TTGAGAAGGTCATGCGTGCACTTGGTGACTACTTGGGTGTGAAGGTTCATGCATGTGTTGGAGGAACCTCAGTTCGTGAGGAC
CAAAGGATTCTTGCAAGTGGAGTGCATGTCGTTGTTGGTACTCCTGG*TCGTGTGTTTGACATGCTCCGCAGGCAGTCTCTGCGCCCTGACAACATCAAG
ATGTTTGTCCTCGATGAAGCTGATGAGATGCTTTCCCGTGGTTTCAAGGATCAGATTTATGACATCTTCCAGcttctCCCaggg*aagATTCAAGTTGGT
GTCTTCTCTgccacCATGCCCCCTGAAGCCCTTGAGATTACCCGCAAGTTCATGAACAAGCCAGTGAGGATCCTTGTCAAGAGGGATGAGCTCACCCTTG
AGGGTATCAAGCAGTTCTATGTCAATGTGGAGAaggaagagtggaagCTTGACACACTGTGTGACCTGTACGAGACTCTTGCCATCACCCAGAGTGTCAT
CTTTGTGAACACCCGCCGCAAGGTGGACTGGCTCACCGACAAGATGAGGGGCAGGGACCACACCGTCTCCGCCACTCACGGAGACATGGACCAGAACACT
AGGGACATCATCATGAGGGAGTTCAGATCAGGTTCTTCACGTGTTCTCATCACCACTGACCTGCTTGCGCGTGGTATTGATGTCCAGCAAGTGTCCCTGG
TCATCAACTATGACCTCCCGACCCAGCCAGAGAACTACCTGCATCGCATCGGTCGTAGTGGTCGGTTCGGGAGGAAGGGTGTGGCCATCAACTTTGTGAC
CCGTGAAGATGAGAGGATGCTGTTTGACATCCAGAAGTTCTACAACGTGGTGATTGAAGAGCTCCCAGCCAACGTTGCCGACCTTCTGTgagcggggcGG
GCTgtggaGAACATATGTTGCTAGGCTGTGGTTCTATGTGCTGAGGAGGGAGGcgttgCTGCTCAtgctgCTGTTGCTGGAGTCCTCACTTTATTTGTTA
AGACTATGTAATGACCGAATGATGTTATTTGTTTGTGTCATCCTTGACTCTTTACCTACCGCATgtaat*cctGCAAtcggtactagtaatgttatcgtt
attaaaa
page-top