Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15274  (registered. 2002)
Contig Information
Length 994 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_r Root 3
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ascorbate peroxidase [Hordeum vulgare subsp. vulgare]
Score 1222
Evalue 2.86183e-132
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15274
atTCGGCACGAGGCTGCCTTCTTCTTCAGTTACCCCTCGCCTTCTCCCCCGCCTGATCGGAGTCTCGGCCGCGGCAGCCATGGCGAAGACCTACCCCGTC
GTCAGCGCCGAGTACCAGGAGGCCGTCGAGAAGGCCCGGCAAAAGCTCCGCGCCCTCATCGCCGAGAAGAACTGCTCCCCGCTCATGCTCCGCCTCGCGT
GGCACTCGGCTGGGACCTTCGACGTGTCGTCCAAGACCGGCGGCCCGTTCGGGACGATGAAGAAGCCGGCGGAGCAGGCGCACGCCGCCAACGCGGGCCT
GGACATCGCCGTGCGGATGCTCGAGCCCATCAAGGAGGAGATCCCCACCATCTCCTACGCCGATCTCTACCAGCTTGCGGGAGTTGTCGCCGTGGAGGTG
TCTGGTGGGCCCGTGATCCCCTTCCACCCAGGGAGGGAGGACAAGCCTCAGCCCCCACCTGAGGGTCGCCTCCCTGATGCTACCAAGGGTTCTGACCACC
TAAGGCAAGTCTTCGGCAAGCAGATGGGCTT*GAGTGATCAGGATATTGTTGCCCTCTCTGGTGGCCACACCCTGGGAAGGTGCCACAAGGAGAGGTCTG
GCTTTGAGGGACCCTGGACAAGGAACCCTTTGAAGTTTGACAACTCTTACTTCACGGAGCTTCTGAGTGGTGACAAAGAGGGGCTTCTTCAGCTTCCAAG
TGACAAAACCCTGCTGACTGACCCTGTCTTTCGCCCTC*TTGTGGAGAAATATGCT*GCGGATGAGAAGGCTTTCTTCGAGGACTACTACTGCTGCTACT
ATGCGATCAGGGTGATCTTGTTCTGCGTTAGACTAGGGGTCAGTGTGAACCTGCAGACTGCTAAGTAATCATCTCTGTAATAATGTCCGTTGGCTTGAGG
CCATACCTTGTACTCTGTCAGTGGTTTGTGTGCCGTTGCACTCGATCGCCTTTATGCCACAGATCTATCGAatgaaatGCAGTaggacttttca
page-top