Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15268  (registered. 2002)
Contig Information
Length 1103 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 3
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0402300 [Oryza sativa (japonica cultivar-group)] >gi|50878377|gb|AAT85152.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|50878430|gb|AAT85204.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579044|dbj|BAF17407.1| Os05g0402300 [Oryza sativa (japonica cultivar-group)] >gi|215697746|dbj|BAG91740.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196770|gb|EEC79197.1| hypothetical protein OsI_19905 [Oryza sativa Indica Group]
Score 993
Evalue 1.19793e-105
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15268
gcGAAATCCCCAATTCCCCACCACCGACAGCGTCGGTGAGAG*AGATGGCGTCGGCGACGGAGATGCAGCCGCTGGCACCGTCGGGCTACCGCCGGGCGC
CGGAGATGAAGGAGAAGGTGGAGGCGTCGTCGATCGACCTGGAGGCGGGGAACGGGGAGACGCTCTACCCGGGGATCTCGCGCGGGGAGAACGCCCTCCG
CTGGGGCTTCATCCGCAAGGTCTACGGCATCCTCTGCGCGCAGCTGGTCCTCACCACCGTCGTCTCCGCCATCACCGTCTTCTACCCCACCCTCAACGCC
ACGCTCTCCAACTCGCCCGTCCTCGCGCTCGTGCTCGCCGTCCTCCCCTTCATCCTGATGATCCCATTGTACATCTATCAGCACAGACACCCT*CACAAT
CTTGCTATCTTGGGTTTGTTCAC*TCTGTGCTTGAGCTTCAGCATTGGTGTGGCTTGTGCAAACACTGAA*GGAACTATTGTGCTTCAAGCATTGGTACT
GACCTCAGCTGTGGTTGTCTCTCTGACTGCATACACATTCTGGGCCGCAAAGAAGGGCAAGGAATTTAGTTACCTTGGACCGTTTCTGTTTTCTGCTCTC
ACCATCCTGGTCGTGATAAGCTTTACCCAGATCTTCTTCCCATTTGGACCTGCATCGAATGCTGTGATCGGTGGGTTTGGAGCTCTAGTCTTCTCAGGCT
TCATCGTCTACGACACTGAGAACTTGATAAAGCGCCACACTTATGACGAGTACATCTGGGCGTCTGTTGAGCTTTACCTCGACATCCTCAACCTGTTCCT
GACCATCCTACAGATGCTCAGGCAGAATGACAACTGATGGGTCCTGTCTGAACCACCAGGACCTTGTGCCAACCCAGGCATATGTCCAACATTTATCAAG
TCTTTTGAATTGCTATCTACATAACTTGGAAGACATGGTAGTAAGTTTTTGCCATCATCCAGAGATGAGGCCAAAGTACAACCATATGTATAGGTGTTCT
*ATTGTGAGTTTATGTGCCTGAGTGTTGTTAAACTGCCAACAATCagtgatcgtatgaacgttttgtaccaacaattgtcgcgtcgtttcgtttgtgcgt
gtt
page-top