Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15251  (registered. 2002)
Contig Information
Length 1380 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 5
Wh_r Root 3
Wh_yd Spikelet at late flowering 3
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_012747 [Oryza sativa (japonica cultivar-group)]
Score 689
Evalue 5.55172e-129
Total Hit Count 144
Registered year 2002
Contig Sequence     [ Download ]
>Contig15251
tacccacaaacaagaaaggggcgatgGAATTTATTTT*CAGGT*CTGTTTC*ACTTGACAAAGTTAACACAGAAAAGCAATACACACTGGATGAGTTCCC
GCAAAGAACACTGAGCACCGAAACATAAAAACGCTGACGATGTTCGGATGATGCCATCAACAAAGATACCATAAGCTAGAGTAAAGAGTTCAGCTGGATC
CTCCCTGGCTCCCTGCTTGACTATCTTGTATGTTCAGTAACAGCACTTCACTCATCGTCATCGTCGTCGTCCTTCTTGAGGCGAGTGGTTCCGCCGACTT
TGTCGATGGGCAGCTTCATGTTGCCAAAGGGGGTGTCGACATCGATCTTGCCCTTGATGCTGTAGCCGGTGCCCCTGCCCCTGATCATGTCCCAGACGGC
AGATCCCAGGTCCTTGGGCCTGAAGGTGAAGGGGATCTGCATCTTGGTGATCCCCTGCTTCTCGATCCTGGTGGAGTCGGTGAGCTCCGCCTCCACCACG
CT*GTCGTCGCCGAGCCACATCTCGTACTGGAGCAGGTTGAGCCCGAGGTCGAAGTCGTTCTTGTTCTCCAGGCTCAGGTGGATGGTGGCC*GTGGTCTC
CTCGAAGG*AGAAGTGGTGGAACTTGATCTTGTCCACGTCCACGTCGGGCTTGTACGGGATGGGGATCTCCCCGGACTTGTCCAGCGGGATCTTGATGCG
GCCGAAGACGGGCACGTCccaCGAGGAAGATGACCCGGAGCAGGTAGGGGATGATGCTGCCCGGCTTGATGTCCGCGTAGGTGCTCCGGATGTCGTCGAA
GTCGAGCGTGATGGGCACCTTGACCGTCTCCTCGCCGTGCGCGCGGATGGTGCCGGCGTCCGGGATGAGCCCCGCGACGAGCTTCCGGCCGTCGCTGTCG
ATGAGGTAGTCGATGTCGACGAGCGGG*ATGGGCACCGGGTTGGGGTTCTTGATGAGCACGTCGACGACGAGGTCGGCGCGGTGGAGGCCGATGTGGGGC
ACGTGGATCCGGGCCACGTCGGCGCTGGGCTTGCCGAACCCCACCGCCTCCTCGATCTTCTCCCCGATGTCGTGGATGAAGTCCTTGACCTTGTCGATGA
ACCCGCCGCCGCCCTCCTCCCCATCCTCTTTCTTCTCCTCCTGCTTCTTCTTCTTGTCGGCGCCGTCGTCCTTGCTGCTCTTGCTGAAGAGGCCGCGGTC
GGTGACCGTGTTGGGGTTGTCCGACGAGGACGACATGGCCGCTGGCTGGCTGGGGAGGGAGGAAGGGGATCCGGATGGACGGAGCGAGTGGAGATCGCGT
GCGGAGCGTGTCGCGGCCGGCAGCTGGagcgtgacgagtggagcggtagtgggtgcaccctcgtgccgaattncctgcag
page-top