Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15244  (registered. 2002)
Contig Information
Length 1054 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_f Spike at flowering date 13
Wh_h Spike at heading date 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Unknown (protein for MGC:35458) [Homo sapiens]
Score 1148
Evalue 1.19607e-123
Total Hit Count 315
Registered year 2002
Contig Sequence     [ Download ]
>Contig15244
accgatcaccaGCACAGCCGCGCATCCACCGTTGCTAGCAAGGTCGACCAAGCAGCACCGAgcaTGGCTGCTGCCTTCTCCTCCACCGTCGGTGCCCCGG
CTTCTACGCCGACCAACTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCTCCAAGGCCAACAGGTTCACAGT
CATGGCAGCGGAAAACCTCGACGAGAAGAGGAACACGGACAAGTGGAAGGGTCTTGCGTACGATATCTCCGACGACCAGCAGGACATCACCAGAGGGAAG
GGCAT*CGTGGACTCGCTCTTCCAGGCGCCCACGGGCGACGGCACCCACGAGGCCGTCCTCAGCTCCTACGAGTACGTCAGCCAGGGACTCAAGAAGTAC
GACTTCGACAACACCATGGGAGGCTTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTCCATCTCTCCAAGAACTTCATGACCCTGCCCAACATCA
AGATCCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCATTCCAGTGCGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGAT
GAGTGCCGGAGAGCTGGAGAGTGGCAACGCCGGAGAGCCAGCCAAGCTCATCAGGCAGCGGTACCGTGAGGCTGCAGACATGATCAAGAAGGGTAAGATG
TGCTGCCTCTTCATCAACGATCTTGACACCTACATGAGCCAGGCAGCTCTGGGTGATGCTAACCAGGATGCGATGAAGACTGGTTCCTTCTACGGTTAGA
ACATTCTCCATACACACCCACCATCTCTTGCTGCATAGGAGGAGGTAAAGGGGCACAGCAAGGTACTTTGCCTGTACCGGCAGGATGCACCGACCAGACT
GCCAAGAACTTCGACCCAACGGCGAGGAGTGACGACGGGAGCTGCCTTTACACCTTTTAAGCATGCCAatttaatatctgatgttttatcctttgtacct
aagtaccgcatcgcatccaagcgattgctgggcattttgttatataaaaagata
page-top