Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15238  (registered. 2002)
Contig Information
Length 1414 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_SL Seed DPA30 8
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Fructose-bisphosphate aldolase cytoplasmic isozyme; AltName: Full=Gravity-specific protein GSC 233 >gi|41398198|gb|AAS05825.1| fructose 1,6-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878379|gb|AAT85154.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878433|gb|AAT85207.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|125594188|gb|EAZ34247.1| hypothetical protein OsJ_017730 [Oryza sativa (japonica cultivar-group)] >gi|169244417|gb|ACA50482.1| fructose-bisphosphate aldolase [Oryza sativa Japonica Group]
Score 1714
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15238
agaaaact*aaagcatgtgtactcagcatataacaggtttTACCACCAACTTACTATACGCAGCACTCAGGTTACACGGTATTCGACTCCAAAAACAGGA
TATTCATTCAACTCCAAAAACAAAACTACCTAAGGTAAAGTTCCATGCTAGGTTCGATATCCGAAGGATATATCAGGACCCTGAAAACCAAACGATAATA
CTGGTAAGCAGGACACCCAAACGTGCCACAGCACCGAAGGTAGATCAGTACTTGTAGTCCTTGACGTGGAGGCTCTCGGAGGCGCCCTCGCCAAGGGTGG
CATCGCCCTTGTAGGTGCCGAGGGTGGCCTCGGAGTTGGCCTTGCACCTCACCAGGAACGCCTTCCTGGCCTTCTCCTCGTTCTCCGCCTTGCCAGCCCA
GGCCTTGAGGGTGCTCTGCTGGAGAGCACGCCCGAAGGAGAAGGACAGGTTCCAGGGCTTCTTGGTCTGGAGCTTGTTCATGGCGTTCAGGTTCAGGGTC
GCCTCCTCCTCACTCTGTCCACCGGAGAGGAAGACAATGGCAGGGACGGCAGCAGGGACGGTCCTCTGGAGGGTGCGGACGGTGTACTCAGCAATCACCT
CAGGGGCTACCTT*CTTGGCGTCGGAACCAGGGGTAACCATGTTGGGCTTCAGGAGGGTACCCTCAAGGAGGACATGCTGGTCGTTGAGAGCCTTGTAGC
AGGCAGCAAGGACCATCTCGGTCACATAAGCACAGCGGTCAATGTCATGAGGTCCATCAACAAGGATCTCAGGCTCAACAATGGGCACCAGCCCATTCTC
CTGGCAGATGATGGCATAACGAGCCAGACCCTGAGCATTCTGGTCGATGGAAAGCTGTGATGGCTCGGTGAGGCCAATCTTGAGGACAGCACGCCACTTG
GCAAAGCGGGCACCAGCCTCATAGTACTTGGCACAGCGCTTGCCAAGGTCATCAAAGCCCTGGGTAGTGGTCTCACCGTTGGTTCCAGCGAGCTCGACGG
TACCCTTGTCCACCTTGATGCCAGGGAGGACGTTGCCCTCCTTGAGGATGTCGACGAAGGGCTTGCCACCCTTGGTGCTCTGGTACAGGGTCTCCTCGAA
GAGGATCACGCCGCTGAGGTACTGGAGGGCTCCAGGGGTGCAGAAGAGGAGCTCACGGAGGGCGCGACGGTTGTCCTCAACATTCTCAACGTTGATGCTG
GCGAAGCGCTTGCCGATGGTGCCGGTGGACTCGTCGGCAGCAAGGATACCCTTGCCAGGGGTGCCAATGTAGGCAGCGTTCTTGATGAGCTCATCCTTGT
ACTTTCCGCAGTAGGCCGACATGGTCGATGCTCGGGG*AAGATTCGAGAGCgacagagggaggggagatttgggggctggcaggcaggggaggcctcgtg
ccgaattncctgca
page-top