Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15233  (registered. 2002)
Contig Information
Length 821 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 4
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ATP-dependent RNA helicase [Nocardia farcinica IFM 10152] >gi|54018054|dbj|BAD59424.1| putative ATP-dependent RNA helicase [Nocardia farcinica IFM 10152]
Score 89
Evalue 0.492734
Total Hit Count 72
Registered year 2002
Contig Sequence     [ Download ]
>Contig15233
aaagTGGGTCTTGAAGGacccgg*cTTCATTGGATAAACACGGCAGTACATATTACAACAGG*ACCAAAATAGAAAGGAACATTACATTAAGTCCCTGAC
TTTTACAAGGAGGACCCCAGACTGAAAGCAAGAAACGCGATCGGGTCCTTGACAGCCGCCGCCCAGATTGAACCTCGCccgTCGCCGGGGACGAACCACT
TGGCACGACGGAAATCGCCATGGAAGCATCACCTGCTCGCCATAGCCTCCGAGCCGCCACTGGAACTGCCTCCCATCAGGCACGCAA*GCCGGGAGGAAT
ATAGTCAGCCGCCATTCGGCTAGAAGAAACAGGGCACCTACGAAGACCGGCAGCCATCGATGGGCGCCGTCGCTCCACCAAAGGGACCTCTGCTGATATG
CTCGAACTCGACCTATAAACTTCAGGATTCTGCAACTATCCTGCTTCTCATCCACCACCATGGTAGCCTGAGAAAACAAGCAGTAGCAGTTGGATGCCCT
CCAGATCAGGGAACACCACAACACCAGAACGAGCTTATTCAAGGGGATCTTGCCAGATCCGGCGTCTTCCACTTTCCACCACCATGGTGGCAAGAAAGAA
AACGACGGAGGCCACCACCAGACGCCGCTCGAGAGCTCCAGTGGTTTGCATCCCCACGGCATAACGCCAGACCACGGCATGAAGCCAAGACAAACTAAAA
CTACTGCTGCCCTAATATACACAAGGAAGACCCGAGCTCCTCTCCATATCCATCGCCGGCCGGCAGCGCCGTCGGACGAGGCGTTGGATCGGGCCGGGCA
ACCCGGTCGACTCtcaaaagc
page-top