Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15202  (registered. 2002)
Contig Information
Length 1030 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 4
Wh_h Spike at heading date 4
Wh_r Root 3
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0586400 [Oryza sativa (japonica cultivar-group)] >gi|46806275|dbj|BAD17483.1| putative GTP-binding protein yptm3 [Oryza sativa Japonica Group] >gi|113536798|dbj|BAF09181.1| Os02g0586400 [Oryza sativa (japonica cultivar-group)] >gi|125540069|gb|EAY86464.1| hypothetical protein OsI_07846 [Oryza sativa Indica Group] >gi|125582673|gb|EAZ23604.1| hypothetical protein OsJ_007087 [Oryza sativa (japonica cultivar-group)] >gi|215686464|dbj|BAG87725.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215712319|dbj|BAG94446.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1000
Evalue 1.66252e-106
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15202
gattcccctccccctcccttctcttaaaccaatcagacgctagaatCCTtggcaattcGCCGCTCCTCCGATCCGTTCGCCGCCGCCGGGATCGACCATG
TCGTACGCCTACCTCTTCAAGTACATCATCATCGGCGACACAGGCGTGGGCAAGTCATGCCTGCTGCTGCAGTTCACCGACAAGAGGTTTCAGCCCGTGC
ACGACCTCACCATCGGCGTCGAGTTCGGCGCCCGCATGATCACCATCGACAACAAGCCCATCAAGCTCCAGATTTGGGACACGGCTGGCCAAGAATCATT
CAGATCTATAACAAGATCATACTACAGAGGTGCTGCTGGTGCTCTTTTGGTTTATGATATCACCAGGA*GGGAAACTTTTAACCATCTTGCGAGCTGGCT
AGAAGATGCAAGACAGCATGCAAATGCCAATATGACAGTGATGTTAATCGGAAACAAATGTGATCTGTCTCATAGACGGGCTGTCAGCTACGAGGAGGGT
GAACAGTTCGCCAAGGAGCATGGTCTAGTCTTTATGGAAGCATCTGCAAAAACAGCACAAAATGTTGAGGAGGCATTCATTAAGACGGCTGGAACAATAT
ACAAGAAAATCCAAGATGGTGTTTTTGATGTATCTAATGAGTCCTACGGAATCAAAGTTGGCTATGCTGTCCCCAATGCATCCGGAGGTGGTGCTGGCTC
GTCCTCTCAAGCAGGTGGCTGCTGCAGTTAAGCAAGTTTACGACCAAGTCCTATCATGTGAGACTGAAAACAGCTGCCCAGGTTGTTGTCCTTCCTTCCG
CCATTGACGGTGTAATCAGTGAGCAAATGTTCATCAATGGTGCTTGTCTACACAGCGCAATCTTTCTGTAAAGCAAACATCTATAGTTTCTGTCCATTTG
TGTCTGTAACTAAATGGTGTGGATATTCATTTGTTCGATGTAATAATGC*TTTGTAGACTACAGACATGGCTGTGCAGCAATTg*ccctgatCCATGTCA
caatatttgcccanatccttccattgcgca
page-top