Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15197  (registered. 2002)
Contig Information
Length 726 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 9
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L37 [Zea mays]
Score 447
Evalue 1.17653e-42
Total Hit Count 296
Registered year 2002
Contig Sequence     [ Download ]
>Contig15197
cccctttttttttcaaatcaaactttataaattatggtttcaaaatgatgctcaattatgtgcgtcaacatcATTTGAAATATTATGTTGACATATTAGT
CAATGCAGATGCTCAAATTTTGAAGTTTTTCAGCCAAACTTCACAACAGGAAGATTGGAGAGCCGATGACACAAG*AGAAAAAAAAGG*AGAAAGAGAAC
TGATCACGTACTTGTAACATTCAGACAAATTTGGTCTTCGATTCAGCGGTCAATTTCCAAACCCATGCAACAAAACATATCAG*ATCCATACTCAATT*C
TATAGCAACAATAGTTTAGGTGGGGTACAATCCAAGCAAAAGTCTTTAAATTCTAGCTTCACGGG*ATTCCTGCTGGGGCAAAATCCAG*ACCTAGTTGG
CCGCGGCCCTGTTCCTGGGGGCAGCCTCGGTACCTTCTCTGAAGTTGCTCTTGAACCTGCGAGGCACGTGGCGCATGTACCTCATCCTTCCAGTGCCGGT
GGTCTTGCGCCTGATGGCTTTCACACTCCAGTTGTACTTGCGGATGCGGGCGGCGGGGTAGCCGCACGAGGAGCAGGTGCTCTTCTGGAGGTGGAAGCTG
CGGCGGCCGCAGCGGATGCAGAGCGTGTGGGTCTTGTTCCGGCGCTTGCCGAAACTGCCGGTACCCT*TCGTCATCG*CTTAGGGTTGGAGGAGACGAGC
GAATGGGAGTGgccctcgtgccgaat
page-top