Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15195  (registered. 2002)
Contig Information
Length 1077 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_f Spike at flowering date 3
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit maize 20S proteasome alpha subunit [Zea mays] >gi|11967891|emb|CAC19494.1| maize 20S proteasome alpha subunit [Zea mays]
Score 837
Evalue 3.30251e-125
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15195
aattcGGCACGAGGCACAagncccgCACCCGCACCCGCACCCGCACCCGCACAACAG*AG*ACCCAG*AGCAGGCGACACACCGCCCAGGCCCAGCTCCA
GCTCCGGCGAGATCTCCGGCGACCCTTCGAGATGAGCCGCGGATCGGGCGCGGGCTACGACCGCCACATCACCATCTTCTCCCCCGAGGGCCGCCTCTAC
CAAGTCGAGTACGCGTTCAAGGCGGTCAAGTCGGCGGGGGTCACCTCGATCGGCGTCCGCGGCAAGGACTCCGTCTGCGTCGTCACCCAGAAGAAAGTCC
CGGACAAGTTGCTGGATGACACCAGCATCACGCACCTCTTCTCGATTACCAAGTACACCGGGCTTGCTTGCCACCGGCC*TCACAGCTGATGCGAGGTCC
TTGGTCTCCCAAGCAAGAAATGAAGCAGCTGAGTTCCGTAAAAAATGGGGATACGAGA*TGCCTGTGGATGTATTAGCAAAATGGATAGCAGACAAAGCA
CAAATATACACGCAGC*ATGCGTACATGAGACCCCTTGGTGTAGTTGCCATGGTCTTGGGTTATGATGAAGAGAAAAATGCTCAGCTCTTCAAGTGTGAC
CCCGCAGGTCACTTCTTTGGACACAAGGCAACTAGTGCCGGACTGAAGGAGCAGGAAGCAATAAATTTTCTGGAGAAGAAAATGAAGGATAGCCCGCAGT
TCACATATGACGAAACTGTTCAGATTGCAGTTTCTGCATTGCAATCTGTTCTGCAGGAAGATTTCAAGGCTACCGAGATCGAGGTCGGTGTTGTGAGGAA
AGAAGACCGTGTCTTCCGGTCGCTCACGACAGAGGAGATTGATCAGCACCTAACAGCCATTAGCGAGCGCGACTGAGCTATGAGACTGTAGCTGTCAATG
CACCATAAACTGTTATTTTGTTTCATAGCCAGCCAAGAAACATTCAGTGAATCATTTCATGTGTAGCAAGAAAGACGGGCATCCACTCTGCCATGTATTA
GTTGGATCATCC*TTTGTGTGGTTGAATTTGCTACGGctatttctatcgtcttaacctgtnctcag*a*ttatgtgg
page-top