Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15193  (registered. 2002)
Contig Information
Length 549 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0680300 [Oryza sativa (japonica cultivar-group)] >gi|113612180|dbj|BAF22558.1| Os07g0680300 [Oryza sativa (japonica cultivar-group)] >gi|218200264|gb|EEC82691.1| hypothetical protein OsI_27348 [Oryza sativa Indica Group]
Score 213
Evalue 8.42359e-16
Total Hit Count 15
Registered year 2002
Contig Sequence     [ Download ]
>Contig15193
ttcggcacgagggaGAGAGAAAAGCAGCGAG*ACGCGAATCAGCGGCGGCGATGGCTCTCCCGGCGTCCGGCTCCACCCTCTCCCGCTTCCTCTCCTCCC
GCCGCATCCAGCCCACGGACATCACCGCCCTCGCCACCTGGGGCGTCTTCGCCGGCAGCGCCGCCATCTACCTCGTCCAGCCATTCGACTGGATCAAGAA
GACCTTCTTTGAGAAGCCCGAGCCAGAGGCATGAGTGTCATACATTGCAACTTTTGATGCCTACATTTTCAGGACGATTCTCTGAGTTTGGATGACCCA*
GCCAATAATATACAAGACCCTCGTGTTCCCTTGTTTGATTTCCCATCCAGATGTAGGTTTCCTCTTGCGTTGCATGTAACCCTCACCATGGGAGGGGAAT
GATCATGTAAATTTTATTTGCCGTCACAGAGAAAAGAAACTGTGCT*CGTGTTTATTTCTCCTCTCTTGCTACGGTCACCAAAGAGTGAGCTTTGTCTCA
GAGCAGGAAACTCACGCTcttgcatggtgttttgtgttcaaaaaaaaaa
page-top