Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15184  (registered. 2002)
Contig Information
Length 1034 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSJNBa0068L06.9 [Oryza sativa (japonica cultivar-group)] >gi|116317777|emb|CAH65755.1| OSIGBa0123D13.4 [Oryza sativa (indica cultivar-group)] >gi|125546927|gb|EAY92749.1| hypothetical protein OsI_14504 [Oryza sativa Indica Group] >gi|125589074|gb|EAZ29424.1| hypothetical protein OsJ_012907 [Oryza sativa (japonica cultivar-group)] >gi|215697911|dbj|BAG92153.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737534|dbj|BAG96664.1| unnamed protein product [Oryza sativa Japonica Group]
Score 919
Evalue 4.10443e-97
Total Hit Count 193
Registered year 2002
Contig Sequence     [ Download ]
>Contig15184
aaaatttagcaaacaTGTGTGCTTATTTCTTATGATGAGATATTATTGACTTCACCACACCACAAG*CAAACAT*CGAATAACAATCATCCACGTGCAGT
TTCTACTTGAAGCGACAAATTTGAAGAATCCGCACAAAGGAAATGATACACCACACCACAGGATGTCATTATCTACATTTTATTGTTCTTCACCATCTCT
TCCACGTCGAGCTCTACCGCCAAAACCGGCAAATCCTGGAACATGGCTACACGGCTGTTGTCCACTGGGCCATGATCAACAGCAGTTCTTAAAGAGTATA
TAACTCTCCCAACAATATCAGTCATAGGGACCGGCCCAAATAGGCGGCTGTCCCTAGCTTCCTTTGCCTTTAGTTCTTGGTTATCCGCCGTGACCCAGCA
TTCGTCCTTGTCAAGTACAAAGGGCTCATCCTTCTCATCAGTAGAGACCATCTCATAGCCTTGCACTGCA*GCCAGTCGTCGGACAATTAAATCATCGGA
TTTCTCTGGGTCCTTCAACAAGACGATGTCCCCAACAAAGAGTTCTTTTGGGGATAAAGTGGCGAGCTTTCTGACGAGAACGGTTCCTCCGGTCGGAGCC
ACGACGGGGGCCATGGCTTCGCCCCCTTTGATCCACTGCGGGAAGGTGAGCTTGCCCTGGAAGAAGCTCTTCCAGATAGCATCAGTCATCTCAGTGCTGT
TGATCTGCCCG*ACGGTGTACTTCTTCCAGGAGAGGGAGATGGAGTACTCGAACTTGTGGGCGGCGTAGCGGAACCAAGTCGACAGCGAAACCATCTTCT
TTCCCTCTCCCTCGGAGGAGGACCTCGCTCTTCCTCCTCCGCCCGCTGTCCTGATCCCCTCTCTCCCGCTCGATTGGGACGGCGGCTACCGCTGCTGCTC
CCGGCCGGAAATCCTGGAGCGCGGAGGGGGGGAGGGAGGGGGGCTGCCTGGCGGGCGGACACCGGAGG*AGGAGGAGGAGGAGGCGGCGACGGCGAGGGT
GGGAGAGAGGGGATGCGACGAGGTGGGAGcgggc
page-top