Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15168  (registered. 2002)
Contig Information
Length 1417 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_SL Seed DPA30 3
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_005318 [Oryza sativa (japonica cultivar-group)]
Score 1900
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15168
aggaattcggacgagggacagatCGAAGCCAAGG*CTTTCTCGTCCTCCTCCCCAAG*ATGCAG*ATCTTTGTGAAG*ACCCTCACCGGCAAG*ACCATC
ACCCTTGAGGTCGAGTCATCGGACACCATCGACAACGTCAAGGCGAAGATCCAGGACAAGGAGGGCATCCCCCCGG*ACCAGCAGCGCCTCATCTTTGCT
GGCAAGCAGCTCGAGGATGGTCGTACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTGGTGCTCCGCCTTCGCGGTGGTATGCAGATCT
TCGTGAAGACCCTGACGGGCAAGACCATCACGCTTGAGGTGGAGTCCTCGGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATCCC
CCCGGACCAGCAGCGCCTCATCTTCGCCGGCAAGCAGCTTGAGGATGGCCGCACTCTGGCAGACTACAACATCCAGAAGGAGTC*CACCCTCC*ACCTGG
TGCTCCGCCTTCGCGGTGGTATGCAGATCTTCGTGAAGACCCT*GACGGGCAA*GA*CCATCACGTTG*GAGGTGGAGTCCTCGG*ACACCATCGACAAC
GTCAAGGCCAAGATCCAGGACAAGGA*GGGCATCCCC*CCGGACCAG*CAGCGCCTCATCTTCGCCGGCAAGCAGCTCGAGGATGGCCGTACCCTTGCTG
ACTACAACATCCAG*AAGGAGTCCACCC**TCCACC*TGGTGCTCC*GCCTTCGCGG*TGG*TATGCAGAT*CTT*CGTGAAGACCC*TGACGGGCAA*G
AC*C*ATC*ACGCTGGA*GG*TGG*AG*TCCTCGG*ACACCATCG*ACAACGTCAA*GG*CCAAGATCCA*GGACAAGG*AGGGCAT*CCCCCCGG*ACC
AGCAGCGCCTCATCTTT*GCCGG*CAAGCAGCTCG*AGGATGGCCG*TACCCTTGCTGACTACAACATCCAGAAGGAGTCC*ACCCTCCACCTGGTGCTC
CGCCTTCGTGGTGGTATGCAGATCTTTGTCAAGACCCTGACGGGCAAGA*CCATCACGCTGGAGGTGGAGTCCTCGGACACCATCGACAACGTGAAGGCA
AAGATCCAGGACAAGGAGGGCATCCC*TCCGGACCAGCAGCGCCTCAT*CTTTGCCGGCAAGCAGCTTGAGGATGGCCGCACTC*TGGCAGACTACAACA
TCCAGAAGGAGTCTACCCTCCACCTGG*TTCTCCGCCTGCGTGGTGGCCAGTAAGTGACTGGTCATGGCGTTGCTTCTGTCTCCAGGGTTCACAGGTCTT
GTGTCGCCGTTGTTCT*CCAATGGGTGCCCTTGT*CTGGT*CGTGTCGTTGTTTCCATCACTGAT*CTGTTCGGTTGTCTAAAAACTTCCCACGG*ctTG
GTTATATATTAAtaagt
page-top