Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15152  (registered. 2002)
Contig Information
Length 756 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 17
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glyoxalase family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|125585786|gb|EAZ26450.1| hypothetical protein OsJ_009933 [Oryza sativa (japonica cultivar-group)]
Score 481
Evalue 1.44914e-46
Total Hit Count 62
Registered year 2002
Contig Sequence     [ Download ]
>Contig15152
acttgctgtcGCTGGACATCGCGATTTATTATTTGGTATCGACAG*AGTACAGCATTACGAGTCATTACAGTAG*ACACG*AGCACAATACATTACAGTA
G*ACACGAGCAAGTATGCCACTACTCGCGGACGTGGCTCCCAAGGCGCAGGGTGATCCCGTCACAGTCCCTGATGTAGCCGACCTTCT*GCCCCCAGTTC
TTCTGCTCCGGCGCGCTCACCGGCACCGCCCCGTTCTCCAC*GGCCCGCCGGTAC*GCAGCGTCGACGTCGTCGTAGTCGAAGCAGATCTCCACGGGCCC
TCGCTCACGGAGCGACTTGGGCAGCTGCACCTCGCCCGTGAGCGCGTCCGTCTCCCTCTGGTGCCGCGGCGTGAACGCGATGGTCGTCGAGCCGGTGTCC
AGCTCCGCCCACTTGTGCGAGTCGTCGACCCGGCGGACGCTGTAGTTGAAGGCCTTGGCGTAGAAGGCGGCCGACTTGCCCACATCTTC*GACGTAACAC
ACGATGTACGCGAGCTTAGGTCTCACCGCCCCAGACGCCATGGCTCGTCCCTTCCGTGCGTACGGGTGCTACTGCTAACCACTTTGAGATGGCTCGGTGT
TTGCCTTGAGCTGTTGTGTCTTCTGTATCGACAGAGTACAGCATTACGAGTCATTACAGTAGACACGAGCACAATACATTACAGTAGACACGAGCAAGTA
TGCCACTACTCGCGGACGTGGctcccaaggcgcagggtGATCCCGTCACAGTCCct
page-top