Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15126  (registered. 2002)
Contig Information
Length 1600 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_f Spike at flowering date 1
Wh_yd Spikelet at late flowering 7
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0756600 [Oryza sativa (japonica cultivar-group)] >gi|20161213|dbj|BAB90140.1| unknown protein [Oryza sativa Japonica Group] >gi|113533820|dbj|BAF06203.1| Os01g0756600 [Oryza sativa (japonica cultivar-group)] >gi|125572072|gb|EAZ13587.1| hypothetical protein OsJ_003412 [Oryza sativa (japonica cultivar-group)] >gi|215686400|dbj|BAG87661.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215717159|dbj|BAG95522.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1412
Evalue 5.20622e-154
Total Hit Count 119
Registered year 2002
Contig Sequence     [ Download ]
>Contig15126
ctttctAATGCATTGAAGAG*ATGAACTTGTAACAATTCTTACATCTCACATTGCAAGCCCTTGGCTCAGTGACCACTCAATCCCATCATGGTTTGCTAC
TTTCTGAATCACACAAGAAAGCAACAAAACAACCATTTATAGCTACTGGTAGCTTTAGCCTAAGCTCACATTACTCATCAATCTCATAGAAACCTCAAGC
TTACTAACAAAACTAGTGGCCTCCTCGCCCTTGCAGGGGAGGTTACATACGTATATTCAGGAGATCAGAACAGCACGAGAACGATGACACTAGCCATGGC
A*ATAAGCAGCGCA*ATACTTGCCTTCAACCCAGCAGCCCCATTCAAGCCCCAGACACGGACGTCGTCTATCACCGGCCCGCAGAGCGAGCTGTGGTCGT
CGCTTCTCGTGTTGTAGTAGACGCTGTAGAGCGCAACGCGTGTCCTCTCGGCGCGCGCCGTGAAGTTCACGTTCACGGCGCTGGCTCGTGGCGTTGCCCA
TGGGGGAGTAGTGG*AAGTTCTGGGCCTGGTCGCCGGCGAATGCCATGACAGCCATTGGCGGCTGGCACGAGTCGCCTGCCGAGCCCAGCGTGAACGTCA
GGGTGTACGCCTT*CTGAGGGGTCGTCTCCACCATCTGCGAGATGATGCCCTCCTTGCCGGAGAGAAGCTCGATGGCGCGCTTCCCCTGGGGCACGGTGT
ACTGGTCGGAGTCGACGAAGcggacTGCGCGGTTCGACTCGATCATCCACCCTGGCAAGGCCGATGTCTGCTCGTCAAGGTTCGTCGGGAGCAGGACACC
GAAGCTTGTGTTTGGAAACATCCATGGCCCCTCCTCAAAGTCTCCATTGATCACCATGTTCTCCTTTGCTTTGTCGGGGGAGAAGAGCTTCTTGATGGCC
ACGTTGTCAAGGATAGGCCCGCAGGTCGGGTCGTCCTCCATGCCAGGGTTCCTAAACTCAATGCTGGCCTGCTCATCCACTGCTTGGAAAGCCAGTGCAT
ATGCATCCCAGCCTTCTATGCTGTACAGTGTCTGCAGGTCGACTGTCTGCGACACGCTCCCAGCGGAGATGTTCAGTGACTCCA*GCTGCGCGCAGGTCC
GGGCGGCGCTGAATGTGATCGCGTACTCTGAGCCCTTCTCAACCTCCACCACCTGCCCAATGCCTGCATCATTCCCTAGCCGCACAGCATGATCGCCTTG
TGGAACAATAAGGATCATGCCACCCTGGTGCTGGCCTGCGGAAATGAGCTCAACTGTTCCATTGATCATCCAGCTTGGGATCGCTGCGCCCTCGGAAACT
GAAGCAGATTTGACGAAACCGCCAGGTGGTGCTGTCTCGAAATCACCATTCATGAGGAGGCCGTCCTCCACCGGAGCGGCCGAGGCGAGACGACGGGAGG
GCGCCAGCAGAAGAAGCGCCAGCCCCAGACCCAGCAATGCGACGAGCCCTCGCTCCATCTCCTCCTCCGCCTAGCAGCTAGTCCCCCGGCTCCCTCACCA
CCGTTTCGTCCTCGATGTGTAGAAGAGCGGGGGGTGGGAGGTGGGAGTGGGAGTGAGGTGGGTGGAGATTGCAAGCTGACGAAGAAGGGGACACCGGtgc
page-top