Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15102  (registered. 2002)
Contig Information
Length 722 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_dL Crown of seedling 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Protein H2A.5; AltName: Full=wcH2A-2 >gi|536888|dbj|BAA07276.1| protein H2A [Triticum aestivum] >gi|1095224|prf||2108279A histone H2A:ISOTYPE=2
Score 463
Evalue 1.65705e-44
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15102
gtTCCGATCCag*acCAGCCGCCCCCGCATCTCGAGTAGTTTCCAGCTCGCCGG*AGAAGCAGCAAGCAGG*ATGGCCGG*AAGGAAGGGCGGCGACAGG
AAGAAGTCGGTGACCAGGTCCGTCAAGGCTGGGCTCCAGTTCCCCGTCGGCCGCATCGGGCGCTACCTCAAGAAGGGCCGCTACGCGCAGCGCGTCGGCT
CTGGCGCCCCCGTCTACCTCGCCGCCGTCCTCGAGTACCTCGCCGCCGAGGTGTTGGAGCTGGCCGGCAACGCTGCCAAGGACAACAAGAAGACCCGCAT
CATCCCGCGCCACCTGCTGCTCGCCGTCCGCAACGACCAGGAGCTCGGCAGGCTGCTCGCCGGCGTCACCAT*CGCCCACGGCGGCGTGATCCCCAACAT
CAACTCCGTGCTTCTCCCCAAGAAGTCCCCCGCCGCCGCCGAGAAGGAGGCCAAGTCGCCCAAGAAGAAGACCACCACCAAGTCCCCCAAGAAGAAGGTC
GCCACCAAGGAGTAGAATTCCGCATAGCATAGCCATTGTTGCTTAGATCCATTTCTCATGGACAAGATGAGCAGTCTTTTGGTTAGTTAGACGAGTAGTG
GTTCTGTCCTTAGATTCGCTGAGCAAGGGTGACATTGTGTCTGTGATTTCTGTAGGAATGGCTAAATATGCAATCGTTCAGATCTTgATTCTCTTGTTCT
ATCAgtGGATGcaaaaaaaaaa
page-top