Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15089  (registered. 2002)
Contig Information
Length 1067 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 10
Wh_f Spike at flowering date 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 40S ribosomal protein S6 [Zea mays] >gi|195618252|gb|ACG30956.1| 40S ribosomal protein S6 [Zea mays] >gi|195625928|gb|ACG34794.1| 40S ribosomal protein S6 [Zea mays]
Score 948
Evalue 1.8668e-100
Total Hit Count 390
Registered year 2002
Contig Sequence     [ Download ]
>Contig15089
ttttttttttaAATGGCAAGTACTTGAGTAGAAACCAACATACAACGATAGAGTACTCATCATGTTCATGGTAACCTGCATCAGGTACAAACCCAGGAAA
ACTACTCCAGTAACAAAACTTCCGATGATAAAGTACGCATGTTCACGCAAAACTGCATCAATTACCAACCCAAGAAAACTGAAAGTAGCGGGTAGATTTT
TCCAACAAAGTACGAAGGACTGTAACCATCTTAAGCAGAGGCAGCAGGAGCCTTGGTGGCAGCAGACAGCTTCGACCTCCTCTTGGCCATGCTCTCGCTC
CGGCGGTCCCTCTGCTCCTTCAGCCTCTGTGCAAGCAGCTTCTGGTACTCGG*CAGCCTCTGACTTCTTCTTGGCGATCCTCTTCTTCTTGTCTGCGATT
CTGGCGCGCTTCCTCTGAAGGGTCAAGGGAGTCACAAGACGCTGGATCTTGGGAGCCTTGCTCACCTTCTTGCCCTTCTTGTTAAGGAAGGTCCTGCGGT
ATGTGTT*GACATAGCTGCGGACATCATCATCCTTGCCAAGGTTGAAGAGCTTCTTGATCTTGGAAGCCCTCTTGGGTCCCCTCATCCTGGGCTTCTCAG
TGTCGGTCAGACCTGGCAGATCATTCTCACCCTTCTTGACAATCACCAAGTTGATAACAGACAGGTCTTGGCTGACAA*TGCAACCACGGACAGACTT*C
CTCCTGCGCTCACCGTTGCGCCTGCCAAACCCACGGAAGCAAGGTGTGCCCCTGTGAAGCAGAAGGCGGACACGCCCAGAAGTTAGCACT*CCTTGCTTC
ATTGGGAAGCCCTGCTTATCACAGCCACCCATGATCTTGAAGATGTAACCCTTGAATTCCTCACCCAGAAGATCACCAACTACCT*CCTGGGAGATTCT*
CTTGTCATAAAGGTTCCGCAGCTtctggtCGTCATCGATCTCGACCTTCTtctggcaccccgtggtggggttcgcgatgttcagcttcatggtggagtcg
cggcacgagctcgccggcggcgagcaacccgggcgactggagtggcctcgtgccgaattncctgcag
page-top