Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15086  (registered. 2002)
Contig Information
Length 663 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L31 [Zea mays] >gi|195606672|gb|ACG25166.1| 60S ribosomal protein L31 [Zea mays] >gi|195617160|gb|ACG30410.1| 60S ribosomal protein L31 [Zea mays] >gi|195639880|gb|ACG39408.1| 60S ribosomal protein L31 [Zea mays]
Score 493
Evalue 4.55654e-48
Total Hit Count 394
Registered year 2002
Contig Sequence     [ Download ]
>Contig15086
ttcggcacgagggaACAGAATCGACCCGGAGGG*AGGAAGCAGCAGCAGCAGGTCAGCGAGGGAGGAGTAGAGGGGATGGCGGACAAGAAGGGCGGAGCG
CCGAGGAAGGAGGAGGTCGTCACGAGGGAGTACACCGTCAACCTCCACAAGCGCCTCCATGGCTGTACCTTCAAGAAGAAGGCACCTAATGCCATCAAAG
AGCTCAGGAAGTTTGCACAGAAGGCTATGGGCACGACAGACGTCAGGATCGACGTGAAGCTCAACAAGCTCATCTGGAGCAGTGGGATCAGAAGCGTGCC
CCGTAGGGTTCGCGTGAGGATTGCCCGCAGGAGGAACGATGAGGAGGACGCCAAGGAGGAGCTCTACTCACTCGTCACCGTTGCCGAGGTGCCTGCTGAG
GGTTTGAAGGGGCTGGGAACCAAGGTCGTCGATGACACTGAGTAGACTCTTTTCTTTATCTACATCGTTAGAATGAGCTGTTATTTGGAATTGCACCAGC
ATGCTTTTTGTAT*CCCGCAGAAGTTTTGGAGTATGGAATATCGGGAGCTATCTATTTTCCTTCATCTAAAT*CTTGATGATTGGTTTTGTCCTTCATAC
TGTG*CTCGTTattgGCGTCAATACAGGATGTGCAgttgagcttgcagttggaaaaaaaaaaa
page-top