Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15085  (registered. 2002)
Contig Information
Length 828 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 2
Wh_h Spike at heading date 3
Wh_r Root 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit thioredoxin h [Triticum aestivum]
Score 594
Evalue 1.6906e-60
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15085
cctTGATAGCAAGGGAACATACAGTATTGTTTTTTCAGTAACAAAACTACAGTTTGTCCAGGATAAAAACACGCATACCAGTAACAAACTTTATATTTCA
GTAACTTGATTGCCGAAGAAGACAGATAACGATCAGACAGGCCAGAGTTACACATTTACACGATCCAAGTTTCAGAACCTTTATTACCACTTTACGTCGG
ATTTGCAGCATTTTAGGAGGCTTGGTAGTGCTACACCATGGGGAAACCATAGGAGCCCCTTGACACTGGGATCAACAAGACAGAACCTGGCACTACAATT
GGAGTGCAGGTTAATTAAGCTAGGATCAGGTAGATGAGATGAACGTCTT*GATCTTCCTGTCAAGCTCATCCTTCTTAGCCCCGACCACGCGACTCACCT
CCTGCCCGCCCTTCACCAGTACAAAGGTCGGCATCGCCTCTACGCGGAATGTCTTTGCAACCTCCGCGAGCTCGTCGACGTCGATCTTGACGAAGAGCGC
GTCGGCGAAGCGGGAGGCCATCTCCTTGAAGGCGGGCTCGATGAAGCGGCAGGGCCCGCACCAGGAGGCGGAGAAATCGATGACCATCAGCTTGGAGGCG
TTCC*GGTGTTCCTCCCAGTGCTTGTCCCAGGCGGGCTTGGAGTGGACGGCGACGACGGCGGAGTCGGGGTCGGTCGCCGGGGAGCGGGGGAGGGGTCCA
CAAGGACGACAGGAAAGAGCCCATGTTTCACTCCGTTTCCTTGGCTCTGTCCGCGCTTGTCTGTCTCGTCGTCGCGAGCGCGAGCGGTAGGGTGGggtgg
gcggctaccgctgaacctcgtgccgaat
page-top